Incidental Mutation 'R5833:Mtmr4'
ID449416
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Namemyotubularin related protein 4
SynonymsZFYVE11, FYVE zinc finger phosphatase, ESTM44, FYVE-DSP2
MMRRC Submission 043221-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5833 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87592162-87616302 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87605049 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 570 (Y570*)
Ref Sequence ENSEMBL: ENSMUSP00000112902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628] [ENSMUST00000134216]
Predicted Effect probably null
Transcript: ENSMUST00000092802
AA Change: Y513*
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: Y513*

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103179
AA Change: Y570*
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: Y570*

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119628
AA Change: Y570*
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: Y570*

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134216
SMART Domains Protein: ENSMUSP00000119660
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 140 204 6.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 95.7%
  • 20x: 84.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 T C 5: 8,958,314 Y1161H probably damaging Het
Adcy2 T A 13: 68,738,603 M276L probably benign Het
Adi1 A G 12: 28,681,042 D166G probably benign Het
Arhgap44 T G 11: 65,038,677 E267A probably damaging Het
Arl11 T A 14: 61,311,062 L107Q probably damaging Het
C1qtnf3 A G 15: 10,975,630 D247G probably benign Het
C4b T C 17: 34,730,673 D1481G probably damaging Het
Cacna1a T C 8: 84,518,697 F242L probably damaging Het
Ccnl1 T C 3: 65,948,501 K298E probably benign Het
Dcaf5 A G 12: 80,348,429 V322A probably damaging Het
Ddr2 T C 1: 170,004,696 N175S probably benign Het
Enox1 T A 14: 77,506,939 M21K probably benign Het
Fhad1 T C 4: 142,002,527 D55G probably damaging Het
Gm5157 A G 7: 21,185,393 M75T possibly damaging Het
Gm6309 A G 5: 146,168,318 S262P probably damaging Het
Gpnmb T C 6: 49,044,018 L82P probably damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Itpripl2 A C 7: 118,489,971 V455G probably benign Het
Kif16b A G 2: 142,707,367 V1087A probably benign Het
Med12l A G 3: 59,265,226 D1801G possibly damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Osbpl1a G T 18: 12,788,362 N128K probably damaging Het
Pcdhb5 T A 18: 37,321,102 H178Q probably damaging Het
Pdlim1 A T 19: 40,230,545 F214Y probably damaging Het
Qk A T 17: 10,216,387 L236H probably damaging Het
Rexo2 G T 9: 48,468,871 D220E probably benign Het
Rras A G 7: 45,021,291 E195G possibly damaging Het
Serpinb11 T C 1: 107,377,662 probably null Het
Sp1 T A 15: 102,430,917 M430K possibly damaging Het
Tardbp A C 4: 148,617,660 V86G probably damaging Het
Trim43c A G 9: 88,843,037 Q203R possibly damaging Het
Vmn1r232 A G 17: 20,913,651 L229P probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87611924 missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87604067 missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87602404 unclassified probably benign
IGL01544:Mtmr4 APN 11 87597611 splice site probably benign
IGL01574:Mtmr4 APN 11 87600647 missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87604150 missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87601124 missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87614234 missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87600783 missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87597693 missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87612003 missense possibly damaging 0.63
Hippie UTSW 11 87613483 missense probably damaging 1.00
incharge UTSW 11 87611042 nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87611127 missense probably benign
R0009:Mtmr4 UTSW 11 87611508 missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87598888 missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87611064 missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87611440 missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87612225 missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87613516 missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87602830 missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87612117 missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87605090 missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87610967 missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87600823 missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87604997 missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87604097 missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87611042 nonsense probably null
R5502:Mtmr4 UTSW 11 87614078 missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87604530 missense probably damaging 1.00
R5907:Mtmr4 UTSW 11 87612050 missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87604151 missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87611019 missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87613483 missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87613527 missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87600613 missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87604605 critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87611237 missense probably benign
R7350:Mtmr4 UTSW 11 87600650 missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87604557 missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87611901 missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87611876 missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87604580 missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87597724 missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87612189 missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87604428 missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87604428 missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87598864 missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87611930 nonsense probably null
R8544:Mtmr4 UTSW 11 87611909 missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87604124 missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87611825 missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87611880 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCTGCTGGAAATCCTATAGGGAG -3'
(R):5'- GCTCCTCAAGTGATTCAAGAAGTTG -3'

Sequencing Primer
(F):5'- TCCTATAGGGAGAGGAGGCTG -3'
(R):5'- AGCTCTACATGTACGCTGTGGC -3'
Posted On2016-12-20