Incidental Mutation 'R5833:Mtmr4'
ID 449416
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Name myotubularin related protein 4
Synonyms ZFYVE11, FYVE-DSP2, ESTM44, FYVE zinc finger phosphatase
MMRRC Submission 043221-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R5833 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87482988-87507128 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 87495875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 570 (Y570*)
Ref Sequence ENSEMBL: ENSMUSP00000112902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628] [ENSMUST00000134216]
AlphaFold Q91XS1
Predicted Effect probably null
Transcript: ENSMUST00000092802
AA Change: Y513*
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: Y513*

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103179
AA Change: Y570*
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: Y570*

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119628
AA Change: Y570*
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: Y570*

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134216
SMART Domains Protein: ENSMUSP00000119660
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 140 204 6.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 95.7%
  • 20x: 84.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Abcb4 T C 5: 9,008,314 (GRCm39) Y1161H probably damaging Het
Adcy2 T A 13: 68,886,722 (GRCm39) M276L probably benign Het
Adi1 A G 12: 28,731,041 (GRCm39) D166G probably benign Het
Arhgap44 T G 11: 64,929,503 (GRCm39) E267A probably damaging Het
Arl11 T A 14: 61,548,511 (GRCm39) L107Q probably damaging Het
C1qtnf3 A G 15: 10,975,716 (GRCm39) D247G probably benign Het
C4b T C 17: 34,949,647 (GRCm39) D1481G probably damaging Het
Cacna1a T C 8: 85,245,326 (GRCm39) F242L probably damaging Het
Ccnl1 T C 3: 65,855,922 (GRCm39) K298E probably benign Het
Dcaf5 A G 12: 80,395,203 (GRCm39) V322A probably damaging Het
Ddr2 T C 1: 169,832,265 (GRCm39) N175S probably benign Het
Enox1 T A 14: 77,744,379 (GRCm39) M21K probably benign Het
Fhad1 T C 4: 141,729,838 (GRCm39) D55G probably damaging Het
Gm5157 A G 7: 20,919,318 (GRCm39) M75T possibly damaging Het
Gm6309 A G 5: 146,105,128 (GRCm39) S262P probably damaging Het
Gpnmb T C 6: 49,020,952 (GRCm39) L82P probably damaging Het
Hyls1 G A 9: 35,472,480 (GRCm39) S312F probably benign Het
Iqgap2 C T 13: 95,811,880 (GRCm39) R707H probably damaging Het
Itpripl2 A C 7: 118,089,194 (GRCm39) V455G probably benign Het
Kif16b A G 2: 142,549,287 (GRCm39) V1087A probably benign Het
Med12l A G 3: 59,172,647 (GRCm39) D1801G possibly damaging Het
Mep1a G A 17: 43,789,055 (GRCm39) H574Y probably benign Het
Osbpl1a G T 18: 12,921,419 (GRCm39) N128K probably damaging Het
Pcdhb5 T A 18: 37,454,155 (GRCm39) H178Q probably damaging Het
Pdlim1 A T 19: 40,218,989 (GRCm39) F214Y probably damaging Het
Qki A T 17: 10,435,316 (GRCm39) L236H probably damaging Het
Rexo2 G T 9: 48,380,171 (GRCm39) D220E probably benign Het
Rras A G 7: 44,670,715 (GRCm39) E195G possibly damaging Het
Serpinb11 T C 1: 107,305,392 (GRCm39) probably null Het
Sp1 T A 15: 102,339,352 (GRCm39) M430K possibly damaging Het
Tardbp A C 4: 148,702,117 (GRCm39) V86G probably damaging Het
Trim43c A G 9: 88,725,090 (GRCm39) Q203R possibly damaging Het
Vmn1r232 A G 17: 21,133,913 (GRCm39) L229P probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87,502,750 (GRCm39) missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87,494,893 (GRCm39) missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87,493,230 (GRCm39) unclassified probably benign
IGL01544:Mtmr4 APN 11 87,488,437 (GRCm39) splice site probably benign
IGL01574:Mtmr4 APN 11 87,491,473 (GRCm39) missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87,494,976 (GRCm39) missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87,491,950 (GRCm39) missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87,505,060 (GRCm39) missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87,491,609 (GRCm39) missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87,488,519 (GRCm39) missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87,502,829 (GRCm39) missense possibly damaging 0.63
Hippie UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
incharge UTSW 11 87,501,868 (GRCm39) nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87,501,953 (GRCm39) missense probably benign
R0009:Mtmr4 UTSW 11 87,502,334 (GRCm39) missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87,489,714 (GRCm39) missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87,501,890 (GRCm39) missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87,502,266 (GRCm39) missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87,503,051 (GRCm39) missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87,504,342 (GRCm39) missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87,493,656 (GRCm39) missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87,502,943 (GRCm39) missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87,495,916 (GRCm39) missense probably damaging 1.00
R2088:Mtmr4 UTSW 11 87,501,793 (GRCm39) missense probably damaging 0.98
R2497:Mtmr4 UTSW 11 87,491,649 (GRCm39) missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87,495,823 (GRCm39) missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87,488,088 (GRCm39) missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87,501,761 (GRCm39) missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87,494,923 (GRCm39) missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87,501,868 (GRCm39) nonsense probably null
R5502:Mtmr4 UTSW 11 87,504,904 (GRCm39) missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87,495,356 (GRCm39) missense probably damaging 1.00
R5907:Mtmr4 UTSW 11 87,502,876 (GRCm39) missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87,494,977 (GRCm39) missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87,501,845 (GRCm39) missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87,504,309 (GRCm39) missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87,504,353 (GRCm39) missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87,491,439 (GRCm39) missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87,495,431 (GRCm39) critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87,502,063 (GRCm39) missense probably benign
R7350:Mtmr4 UTSW 11 87,491,476 (GRCm39) missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87,495,383 (GRCm39) missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87,502,727 (GRCm39) missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87,502,702 (GRCm39) missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87,495,406 (GRCm39) missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87,488,550 (GRCm39) missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87,503,015 (GRCm39) missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87,495,254 (GRCm39) missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87,489,690 (GRCm39) missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87,502,756 (GRCm39) nonsense probably null
R8544:Mtmr4 UTSW 11 87,502,735 (GRCm39) missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87,494,950 (GRCm39) missense probably damaging 1.00
R8971:Mtmr4 UTSW 11 87,493,626 (GRCm39) missense probably benign 0.13
R9562:Mtmr4 UTSW 11 87,493,241 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,504,916 (GRCm39) missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87,503,138 (GRCm39) missense probably damaging 1.00
R9797:Mtmr4 UTSW 11 87,494,962 (GRCm39) missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87,502,651 (GRCm39) missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87,502,706 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCTGCTGGAAATCCTATAGGGAG -3'
(R):5'- GCTCCTCAAGTGATTCAAGAAGTTG -3'

Sequencing Primer
(F):5'- TCCTATAGGGAGAGGAGGCTG -3'
(R):5'- AGCTCTACATGTACGCTGTGGC -3'
Posted On 2016-12-20