Incidental Mutation 'R5834:Mre11a'
ID 449476
Institutional Source Beutler Lab
Gene Symbol Mre11a
Ensembl Gene ENSMUSG00000031928
Gene Name MRE11A homolog A, double strand break repair nuclease
Synonyms
MMRRC Submission 044055-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5834 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 14784654-14837123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14799657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 45 (I45V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632] [ENSMUST00000147305]
AlphaFold Q61216
Predicted Effect probably benign
Transcript: ENSMUST00000034405
AA Change: I216V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: I216V

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 6.3e-15 PFAM
Mre11_DNA_bind 294 462 1.72e-70 SMART
coiled coil region 487 519 N/A INTRINSIC
low complexity region 566 594 N/A INTRINSIC
low complexity region 683 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115632
AA Change: I216V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: I216V

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 1.1e-31 PFAM
Mre11_DNA_bind 294 435 7.6e-49 SMART
coiled coil region 460 492 N/A INTRINSIC
low complexity region 539 567 N/A INTRINSIC
low complexity region 656 672 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136568
SMART Domains Protein: ENSMUSP00000121012
Gene: ENSMUSG00000031928

DomainStartEndE-ValueType
PDB:3T1I|D 1 107 1e-70 PDB
SCOP:d1ii7a_ 3 107 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147305
SMART Domains Protein: ENSMUSP00000116321
Gene: ENSMUSG00000031928

DomainStartEndE-ValueType
Pfam:Metallophos 13 199 1.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147676
AA Change: I45V

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: I45V

DomainStartEndE-ValueType
PDB:3T1I|D 2 50 3e-26 PDB
Mre11_DNA_bind 62 170 1.81e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G A 8: 105,282,123 Q421* probably null Het
Abca13 T C 11: 9,277,974 probably null Het
Adamts20 A C 15: 94,353,584 S441A probably damaging Het
Aen T A 7: 78,907,301 M299K probably damaging Het
Akap3 T C 6: 126,865,833 S472P probably benign Het
Ank3 T G 10: 69,822,257 V158G probably damaging Het
Arfgap1 A G 2: 180,981,162 D324G probably benign Het
Aste1 A T 9: 105,403,415 R448S probably benign Het
Atp10a T A 7: 58,658,618 L55Q probably benign Het
C1qtnf9 G A 14: 60,779,450 G143D probably damaging Het
Camsap2 A G 1: 136,280,388 V1122A probably benign Het
Cbl T C 9: 44,233,779 H37R probably damaging Het
Cfap61 A C 2: 146,129,149 D893A probably benign Het
Chd2 T A 7: 73,478,715 I841F probably damaging Het
Chd9 A G 8: 90,997,164 T622A probably damaging Het
Cntnap3 A G 13: 64,748,577 Y1028H probably benign Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp2c55 A G 19: 39,042,067 I448V probably benign Het
Cyth1 T A 11: 118,192,463 probably null Het
Dcaf13 C T 15: 39,143,642 R324* probably null Het
Dhx37 C A 5: 125,425,730 R42L probably damaging Het
Dock1 T A 7: 134,763,933 V450E probably damaging Het
Ednrb A G 14: 103,820,877 L330P probably damaging Het
Eml4 T A 17: 83,477,741 H778Q probably damaging Het
Evx1 T A 6: 52,315,990 I227N probably damaging Het
G3bp1 T A 11: 55,497,940 V326E probably benign Het
Gata2 T C 6: 88,200,747 V253A probably benign Het
Gbp2 A G 3: 142,633,377 N397D probably damaging Het
Gm14401 C A 2: 177,086,903 H261N probably benign Het
Hacd4 A T 4: 88,398,152 H243Q probably benign Het
Hsd3b1 C A 3: 98,852,939 K245N possibly damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ift27 A T 15: 78,165,243 C86S probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irs3 T A 5: 137,644,559 S206C probably damaging Het
Lefty2 C T 1: 180,893,151 probably benign Het
Mark3 A G 12: 111,624,487 I162V probably damaging Het
Mefv A C 16: 3,716,046 D120E probably damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mtor A G 4: 148,536,536 N1797S possibly damaging Het
Nav1 A C 1: 135,532,406 M393R probably benign Het
Nod2 T C 8: 88,664,639 S510P possibly damaging Het
Nos2 C T 11: 78,928,579 T39I probably benign Het
Olfr474 T A 7: 107,954,906 H88Q probably benign Het
Olfr93 A T 17: 37,151,799 Y58N probably damaging Het
Pcdh7 A G 5: 57,721,628 S842G possibly damaging Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Plaa A C 4: 94,583,469 V10G probably damaging Het
Pprc1 T A 19: 46,065,220 probably benign Het
Ptprt T C 2: 161,560,269 Y994C probably damaging Het
Ripply2 T A 9: 87,015,890 W37R probably damaging Het
Rpgrip1 A G 14: 52,158,382 D1227G probably damaging Het
Scoc C T 8: 83,437,631 D10N possibly damaging Het
Sdk2 A T 11: 113,854,273 I732N probably damaging Het
Six2 T C 17: 85,687,664 K97E probably damaging Het
Slit2 A C 5: 48,259,647 N1014H probably damaging Het
Smc1b A C 15: 85,089,665 L930R probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Spata31 C T 13: 64,922,666 S876L probably benign Het
Spen A G 4: 141,471,843 Y3135H possibly damaging Het
Spta1 A T 1: 174,184,797 probably null Het
Stk3 G A 15: 34,959,018 T336I probably damaging Het
Tas2r118 T A 6: 23,969,877 T62S probably benign Het
Tmprss11d A G 5: 86,306,310 M212T probably damaging Het
Trpc7 A G 13: 56,776,158 L738P probably damaging Het
Ttll8 A G 15: 88,917,246 V413A possibly damaging Het
Usb1 G A 8: 95,333,533 probably benign Het
Vmn1r238 T C 18: 3,123,168 E82G probably benign Het
Vmn2r114 T C 17: 23,310,625 T168A possibly damaging Het
Vmn2r60 C A 7: 42,116,508 P13H probably benign Het
Wdr26 A G 1: 181,203,147 L194P probably damaging Het
Zfhx2 G A 14: 55,073,330 Q636* probably null Het
Zfyve26 A G 12: 79,266,537 Y25H probably benign Het
Other mutations in Mre11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Mre11a APN 9 14825208 missense probably benign 0.28
IGL00429:Mre11a APN 9 14802813 missense probably damaging 1.00
IGL00922:Mre11a APN 9 14799588 missense probably damaging 1.00
IGL01095:Mre11a APN 9 14809824 missense probably benign
IGL01294:Mre11a APN 9 14830915 missense probably damaging 0.97
IGL01871:Mre11a APN 9 14811897 missense possibly damaging 0.95
IGL02194:Mre11a APN 9 14815209 missense possibly damaging 0.70
IGL02213:Mre11a APN 9 14811884 missense probably damaging 1.00
IGL02245:Mre11a APN 9 14815276 unclassified probably benign
IGL02749:Mre11a APN 9 14826591 missense possibly damaging 0.78
IGL02812:Mre11a APN 9 14790670 splice site probably null
bow UTSW 9 14786962 missense probably damaging 1.00
R0050:Mre11a UTSW 9 14830973 splice site probably benign
R0594:Mre11a UTSW 9 14815209 missense probably benign 0.00
R1241:Mre11a UTSW 9 14799639 missense probably damaging 1.00
R1905:Mre11a UTSW 9 14799627 missense probably benign 0.08
R2030:Mre11a UTSW 9 14795805 missense probably damaging 1.00
R2270:Mre11a UTSW 9 14815174 missense probably benign 0.00
R2511:Mre11a UTSW 9 14795769 critical splice acceptor site probably null
R2851:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2852:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2853:Mre11a UTSW 9 14826547 missense probably benign 0.00
R3765:Mre11a UTSW 9 14809847 missense probably benign 0.25
R4612:Mre11a UTSW 9 14802903 missense probably damaging 1.00
R5007:Mre11a UTSW 9 14809820 missense probably benign 0.10
R5343:Mre11a UTSW 9 14811834 missense probably damaging 0.98
R5679:Mre11a UTSW 9 14786919 missense probably damaging 0.99
R5914:Mre11a UTSW 9 14811936 missense probably damaging 1.00
R5935:Mre11a UTSW 9 14786962 missense probably damaging 1.00
R6089:Mre11a UTSW 9 14819464 missense probably benign 0.02
R6393:Mre11a UTSW 9 14785509 start codon destroyed probably null 0.00
R6625:Mre11a UTSW 9 14805391 missense possibly damaging 0.52
R7248:Mre11a UTSW 9 14811913 missense possibly damaging 0.52
R7744:Mre11a UTSW 9 14809832 missense possibly damaging 0.94
R7999:Mre11a UTSW 9 14799669 nonsense probably null
R8179:Mre11a UTSW 9 14797066 missense probably null 1.00
R9293:Mre11a UTSW 9 14799588 missense probably damaging 1.00
R9302:Mre11a UTSW 9 14785530 critical splice donor site probably null
R9368:Mre11a UTSW 9 14825218 missense probably benign
R9410:Mre11a UTSW 9 14805420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGGGAGTTCCTTTATTTCTC -3'
(R):5'- TCCAGGCAAACGTTCGTTC -3'

Sequencing Primer
(F):5'- TCCTGATTGCTAAATGGAAAGCGTG -3'
(R):5'- GGCAAACGTTCGTTCACAAG -3'
Posted On 2016-12-20