Incidental Mutation 'R0548:Tars2'
ID44953
Institutional Source Beutler Lab
Gene Symbol Tars2
Ensembl Gene ENSMUSG00000028107
Gene Namethreonyl-tRNA synthetase 2, mitochondrial (putative)
SynonymsTarsl1, 2610024N01Rik
MMRRC Submission 038740-MU
Accession Numbers

Genbank: NM_027931.3, NM_001163617.1, NM_001163618.1, NM_001163619.1; Ensembl: ENSMUST00000029752, ENSMUST00000074339 , ENSMUST00000098857, ENSMUST00000163530

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0548 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95739976-95760206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95742659 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 470 (D470G)
Ref Sequence ENSEMBL: ENSMUSP00000130269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000029753] [ENSMUST00000074339] [ENSMUST00000098857] [ENSMUST00000117507] [ENSMUST00000123143] [ENSMUST00000128885] [ENSMUST00000131376] [ENSMUST00000137912] [ENSMUST00000147217] [ENSMUST00000153026] [ENSMUST00000163530] [ENSMUST00000195929] [ENSMUST00000196077] [ENSMUST00000198289] [ENSMUST00000199464]
Predicted Effect probably damaging
Transcript: ENSMUST00000029752
AA Change: D551G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107
AA Change: D551G

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029753
SMART Domains Protein: ENSMUSP00000029753
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 558 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074339
AA Change: D525G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107
AA Change: D525G

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098857
SMART Domains Protein: ENSMUSP00000096456
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 6.7e-16 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
SCOP:d1atia2 332 417 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117507
SMART Domains Protein: ENSMUSP00000112665
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 559 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123143
SMART Domains Protein: ENSMUSP00000120300
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 266 4.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128885
SMART Domains Protein: ENSMUSP00000120820
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 251 1.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131376
SMART Domains Protein: ENSMUSP00000114659
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 295 4.2e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137912
SMART Domains Protein: ENSMUSP00000122243
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 140 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147217
SMART Domains Protein: ENSMUSP00000115524
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 80 5.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153026
SMART Domains Protein: ENSMUSP00000114747
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 230 1.3e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155815
Predicted Effect probably damaging
Transcript: ENSMUST00000163530
AA Change: D470G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107
AA Change: D470G

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195929
SMART Domains Protein: ENSMUSP00000143757
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:tRNA_SAD 1 28 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197389
Predicted Effect probably benign
Transcript: ENSMUST00000198289
SMART Domains Protein: ENSMUSP00000143271
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
tRNA_SAD 2 43 2.6e-8 SMART
Pfam:tRNA-synt_2b 97 142 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200376
Meta Mutation Damage Score 0.8929 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdk5rap2 A T 4: 70,349,142 probably null Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Map1b T C 13: 99,431,683 K1510R unknown Het
Marco T C 1: 120,492,038 T187A probably benign Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mmp15 T C 8: 95,372,351 V602A probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Olfr437 T A 6: 43,167,187 I43K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Wdr20rt T A 12: 65,227,315 D344E probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Tars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Tars2 APN 3 95740278 missense probably damaging 1.00
IGL02523:Tars2 APN 3 95741393 missense probably damaging 1.00
IGL02709:Tars2 APN 3 95742071 splice site probably benign
IGL03286:Tars2 APN 3 95754755 splice site probably benign
IGL03348:Tars2 APN 3 95740268 unclassified probably null
B6584:Tars2 UTSW 3 95742150 unclassified probably null
R0657:Tars2 UTSW 3 95748557 missense probably benign 0.00
R1955:Tars2 UTSW 3 95747454 missense probably damaging 1.00
R2070:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R2071:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R3025:Tars2 UTSW 3 95747640 missense possibly damaging 0.71
R3962:Tars2 UTSW 3 95754756 critical splice donor site probably null
R4676:Tars2 UTSW 3 95753091 missense probably damaging 1.00
R4775:Tars2 UTSW 3 95746647 missense probably damaging 1.00
R5208:Tars2 UTSW 3 95747593 missense probably damaging 1.00
R5512:Tars2 UTSW 3 95750416 missense probably damaging 1.00
R5894:Tars2 UTSW 3 95747652 unclassified probably null
R5965:Tars2 UTSW 3 95748152 splice site probably null
R6381:Tars2 UTSW 3 95754487 nonsense probably null
R6953:Tars2 UTSW 3 95753114 missense possibly damaging 0.63
R7042:Tars2 UTSW 3 95750745 missense probably benign 0.00
R7648:Tars2 UTSW 3 95750982 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTGAAAGTCTCATGACCTGAGCCC -3'
(R):5'- AGCTACAAGAGAGTATCCGACTGCC -3'

Sequencing Primer
(F):5'- TGACCTGAGCCCAATCACTTC -3'
(R):5'- GTATCCGACTGCCACTAAGAGAG -3'
Posted On2013-06-11