Incidental Mutation 'R5835:AU041133'
ID449549
Institutional Source Beutler Lab
Gene Symbol AU041133
Ensembl Gene ENSMUSG00000078435
Gene Nameexpressed sequence AU041133
Synonyms
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82128013-82153065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82151212 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 232 (L232H)
Ref Sequence ENSEMBL: ENSMUSP00000100951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105314] [ENSMUST00000201286]
Predicted Effect probably damaging
Transcript: ENSMUST00000105314
AA Change: L232H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100951
Gene: ENSMUSG00000078435
AA Change: L232H

DomainStartEndE-ValueType
KRAB 3 65 1.77e-15 SMART
ZnF_C2H2 105 127 1.16e-1 SMART
ZnF_C2H2 133 155 3.26e-5 SMART
ZnF_C2H2 161 183 1.26e-2 SMART
ZnF_C2H2 189 211 7.37e-4 SMART
ZnF_C2H2 217 239 3.39e-3 SMART
ZnF_C2H2 245 267 1.26e-2 SMART
ZnF_C2H2 273 295 4.79e-3 SMART
ZnF_C2H2 301 323 6.99e-5 SMART
ZnF_C2H2 329 351 5.9e-3 SMART
ZnF_C2H2 357 379 1.03e-2 SMART
ZnF_C2H2 385 407 6.42e-4 SMART
ZnF_C2H2 413 435 8.94e-3 SMART
ZnF_C2H2 441 463 1.6e-4 SMART
ZnF_C2H2 469 491 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201286
AA Change: L233H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144661
Gene: ENSMUSG00000078435
AA Change: L233H

DomainStartEndE-ValueType
KRAB 4 66 7.7e-18 SMART
ZnF_C2H2 106 128 5e-4 SMART
ZnF_C2H2 134 156 1.4e-7 SMART
ZnF_C2H2 162 184 5.3e-5 SMART
ZnF_C2H2 190 212 3.2e-6 SMART
ZnF_C2H2 218 240 1.4e-5 SMART
ZnF_C2H2 246 268 5.3e-5 SMART
ZnF_C2H2 274 296 2e-5 SMART
ZnF_C2H2 302 324 3.1e-7 SMART
ZnF_C2H2 330 352 2.6e-5 SMART
ZnF_C2H2 358 380 4.5e-5 SMART
ZnF_C2H2 386 408 2.8e-6 SMART
ZnF_C2H2 414 436 3.9e-5 SMART
ZnF_C2H2 442 464 7e-7 SMART
ZnF_C2H2 470 492 2.5e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in AU041133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03403:AU041133 APN 10 82138344 missense probably damaging 1.00
R0755:AU041133 UTSW 10 82150890 nonsense probably null
R1924:AU041133 UTSW 10 82151267 nonsense probably null
R2211:AU041133 UTSW 10 82150921 missense probably damaging 1.00
R2400:AU041133 UTSW 10 82150908 nonsense probably null
R3845:AU041133 UTSW 10 82151318 missense probably damaging 1.00
R3914:AU041133 UTSW 10 82151815 missense probably damaging 0.99
R4214:AU041133 UTSW 10 82151389 missense probably damaging 1.00
R4414:AU041133 UTSW 10 82151482 missense probably damaging 1.00
R5315:AU041133 UTSW 10 82151672 nonsense probably null
R6258:AU041133 UTSW 10 82151158 missense probably damaging 1.00
R6877:AU041133 UTSW 10 82151571 missense probably benign 0.24
R7127:AU041133 UTSW 10 82150866 missense probably benign 0.14
R7200:AU041133 UTSW 10 82151101 missense possibly damaging 0.94
R7228:AU041133 UTSW 10 82151271 missense possibly damaging 0.93
R7828:AU041133 UTSW 10 82151220 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCTTTCCAAGTCGCAATTC -3'
(R):5'- TGCAAAGGCTTTACCACATTCA -3'

Sequencing Primer
(F):5'- ACCCTATGATTGCAACGAGTGTG -3'
(R):5'- CTGTGACTTGGAAAGGCTTTACCAC -3'
Posted On2016-12-20