Incidental Mutation 'R5835:Olfr800'
ID449550
Institutional Source Beutler Lab
Gene Symbol Olfr800
Ensembl Gene ENSMUSG00000108114
Gene Nameolfactory receptor 800
SynonymsGA_x6K02T2PULF-11338429-11339364, MOR114-7
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129657694-129662074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129659934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 43 (I43V)
Ref Sequence ENSEMBL: ENSMUSP00000151047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104903] [ENSMUST00000217094]
Predicted Effect probably benign
Transcript: ENSMUST00000104903
AA Change: I43V

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100499
Gene: ENSMUSG00000108114
AA Change: I43V

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 7.3e-43 PFAM
Pfam:7tm_1 38 287 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217094
AA Change: I43V

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Olfr800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr800 APN 10 129660126 missense probably benign 0.26
IGL01915:Olfr800 APN 10 129660650 missense probably benign 0.05
IGL02458:Olfr800 APN 10 129660606 missense probably benign 0.38
IGL02721:Olfr800 APN 10 129659955 missense probably benign
R0032:Olfr800 UTSW 10 129660400 missense probably benign 0.05
R0442:Olfr800 UTSW 10 129659824 missense probably benign 0.00
R1564:Olfr800 UTSW 10 129660015 missense probably benign 0.22
R1580:Olfr800 UTSW 10 129660315 missense probably benign 0.10
R1593:Olfr800 UTSW 10 129660225 nonsense probably null
R1911:Olfr800 UTSW 10 129660112 missense probably benign 0.07
R2001:Olfr800 UTSW 10 129660421 missense probably benign 0.02
R2223:Olfr800 UTSW 10 129659809 start codon destroyed probably null 1.00
R3876:Olfr800 UTSW 10 129660274 missense probably benign 0.39
R3884:Olfr800 UTSW 10 129660538 missense probably damaging 1.00
R4366:Olfr800 UTSW 10 129660531 missense probably benign 0.02
R4689:Olfr800 UTSW 10 129660316 missense probably benign 0.01
R4909:Olfr800 UTSW 10 129660720 missense probably benign 0.01
R5638:Olfr800 UTSW 10 129660100 missense possibly damaging 0.80
R5838:Olfr800 UTSW 10 129660038 missense probably benign 0.41
R6150:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R6248:Olfr800 UTSW 10 129660663 missense probably benign 0.39
R8094:Olfr800 UTSW 10 129660064 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTACTCCTGGACAAATATCTCTG -3'
(R):5'- TCGGTCATAGGACATGATGGC -3'

Sequencing Primer
(F):5'- GAATTTTAAATGCAGATTGGGTAGGG -3'
(R):5'- AGATCAACACAAAATATTTGAATGGC -3'
Posted On2016-12-20