Incidental Mutation 'R5835:Smurf2'
ID449557
Institutional Source Beutler Lab
Gene Symbol Smurf2
Ensembl Gene ENSMUSG00000018363
Gene NameSMAD specific E3 ubiquitin protein ligase 2
Synonyms2810411E22Rik
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106820066-106920715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106836148 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 451 (N451K)
Ref Sequence ENSEMBL: ENSMUSP00000129269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092517] [ENSMUST00000103067] [ENSMUST00000139297] [ENSMUST00000167787]
Predicted Effect probably damaging
Transcript: ENSMUST00000092517
AA Change: N451K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090177
Gene: ENSMUSG00000018363
AA Change: N451K

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103067
AA Change: N438K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099356
Gene: ENSMUSG00000018363
AA Change: N438K

DomainStartEndE-ValueType
C2 13 103 1e-6 SMART
WW 145 177 1.96e-11 SMART
WW 239 271 2.47e-8 SMART
WW 285 317 4.97e-13 SMART
low complexity region 328 338 N/A INTRINSIC
HECTc 399 735 1.75e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144027
Predicted Effect probably damaging
Transcript: ENSMUST00000167787
AA Change: N451K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129269
Gene: ENSMUSG00000018363
AA Change: N451K

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele occasionally exhibit kinked or looped tails and abnormal vertebrae. Mice homozygous or heterozygous for a gene trap allele exhibit increased tumor incidence and delayed cellular senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Smurf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Smurf2 APN 11 106852636 missense probably benign 0.17
IGL00980:Smurf2 APN 11 106836095 missense probably damaging 1.00
IGL01346:Smurf2 APN 11 106830915 splice site probably benign
IGL02016:Smurf2 APN 11 106822678 missense probably damaging 1.00
IGL02937:Smurf2 APN 11 106846047 missense probably damaging 1.00
IGL03136:Smurf2 APN 11 106831048 missense probably benign 0.38
R0513:Smurf2 UTSW 11 106836105 missense probably benign 0.22
R1171:Smurf2 UTSW 11 106852618 missense possibly damaging 0.80
R1459:Smurf2 UTSW 11 106852507 missense possibly damaging 0.78
R1687:Smurf2 UTSW 11 106836070 splice site probably null
R1697:Smurf2 UTSW 11 106824688 missense possibly damaging 0.76
R1706:Smurf2 UTSW 11 106824747 missense probably damaging 1.00
R2064:Smurf2 UTSW 11 106871548 missense probably damaging 1.00
R2072:Smurf2 UTSW 11 106841769 missense probably benign 0.00
R2433:Smurf2 UTSW 11 106868664 missense probably benign 0.06
R5250:Smurf2 UTSW 11 106856179 critical splice donor site probably null
R5531:Smurf2 UTSW 11 106852563 missense possibly damaging 0.47
R5966:Smurf2 UTSW 11 106875901 missense possibly damaging 0.78
R6093:Smurf2 UTSW 11 106868623 missense possibly damaging 0.75
R6230:Smurf2 UTSW 11 106868504 intron probably null
R6373:Smurf2 UTSW 11 106833769 missense probably damaging 1.00
R7011:Smurf2 UTSW 11 106833784 missense probably benign 0.16
R7335:Smurf2 UTSW 11 106846085 missense possibly damaging 0.52
R7472:Smurf2 UTSW 11 106836095 missense probably damaging 1.00
RF002:Smurf2 UTSW 11 106852587 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCAGCCAAGTGATTCCTTCGTG -3'
(R):5'- AAGCAGCTGAACTTCTAAGTAGTAC -3'

Sequencing Primer
(F):5'- TCCTTCGTGAGATGAGATCAGAATG -3'
(R):5'- CAGGTTAAAGTGCTCGCCATTCAG -3'
Posted On2016-12-20