Incidental Mutation 'R5835:Rab44'
ID449568
Institutional Source Beutler Lab
Gene Symbol Rab44
Ensembl Gene ENSMUSG00000064147
Gene NameRAB44, member RAS oncogene family
Synonyms9830134C10Rik
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location29135056-29148980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29148238 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 714 (H714L)
Ref Sequence ENSEMBL: ENSMUSP00000085253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087942]
Predicted Effect probably benign
Transcript: ENSMUST00000087942
AA Change: H714L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085253
Gene: ENSMUSG00000064147
AA Change: H714L

DomainStartEndE-ValueType
coiled coil region 1 68 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
RAB 538 701 1.11e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139931
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Habp2 T A 19: 56,306,786 D36E probably benign Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Rab44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Rab44 APN 17 29139737 missense probably benign
IGL01545:Rab44 APN 17 29147377 missense unknown
IGL02314:Rab44 APN 17 29139353 missense probably benign 0.04
IGL02402:Rab44 APN 17 29140516 missense probably benign 0.01
IGL02492:Rab44 APN 17 29146049 splice site probably benign
R0018:Rab44 UTSW 17 29139380 missense probably benign 0.03
R0135:Rab44 UTSW 17 29138132 missense probably benign 0.01
R0193:Rab44 UTSW 17 29140307 missense probably benign
R0398:Rab44 UTSW 17 29145370 splice site probably benign
R0403:Rab44 UTSW 17 29145261 missense probably damaging 1.00
R0608:Rab44 UTSW 17 29147343 splice site probably null
R0631:Rab44 UTSW 17 29139144 missense possibly damaging 0.91
R0762:Rab44 UTSW 17 29145270 missense unknown
R1128:Rab44 UTSW 17 29140461 missense possibly damaging 0.90
R1681:Rab44 UTSW 17 29140124 missense possibly damaging 0.47
R1706:Rab44 UTSW 17 29138106 missense probably damaging 1.00
R2679:Rab44 UTSW 17 29144477 splice site probably null
R3500:Rab44 UTSW 17 29138067 missense probably benign 0.09
R3709:Rab44 UTSW 17 29139869 missense probably benign 0.08
R4497:Rab44 UTSW 17 29139897 missense probably benign 0.04
R4655:Rab44 UTSW 17 29139194 missense probably benign
R4833:Rab44 UTSW 17 29136337 missense probably damaging 1.00
R4850:Rab44 UTSW 17 29140089 missense possibly damaging 0.95
R4926:Rab44 UTSW 17 29139555 missense probably benign 0.01
R5694:Rab44 UTSW 17 29140500 missense probably damaging 1.00
R5694:Rab44 UTSW 17 29145966 missense unknown
R6146:Rab44 UTSW 17 29135417 start gained probably benign
R6629:Rab44 UTSW 17 29135780 start gained probably benign
R6814:Rab44 UTSW 17 29139810 missense probably benign 0.18
R6865:Rab44 UTSW 17 29139227 missense probably benign
R6872:Rab44 UTSW 17 29139810 missense probably benign 0.18
R7032:Rab44 UTSW 17 29140464 missense unknown
R7058:Rab44 UTSW 17 29138176 splice site probably null
R7207:Rab44 UTSW 17 29138039 nonsense probably null
R7218:Rab44 UTSW 17 29139444 missense
R7418:Rab44 UTSW 17 29140496 missense unknown
R7651:Rab44 UTSW 17 29148205 missense unknown
Predicted Primers PCR Primer
(F):5'- CACTTGCACGCACATGTTG -3'
(R):5'- CCCCTGGTATGTTTGCTCAG -3'

Sequencing Primer
(F):5'- ACATGTTGCTTGGCACCCAG -3'
(R):5'- CTCAGTGGAGCAGAGGTGAC -3'
Posted On2016-12-20