Incidental Mutation 'R0548:Cdk5rap2'
ID44957
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
MMRRC Submission 038740-MU
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R0548 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 70349142 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably null
Transcript: ENSMUST00000144099
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Map1b T C 13: 99,431,683 K1510R unknown Het
Marco T C 1: 120,492,038 T187A probably benign Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mmp15 T C 8: 95,372,351 V602A probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Olfr437 T A 6: 43,167,187 I43K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tars2 T C 3: 95,742,659 D470G probably damaging Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Wdr20rt T A 12: 65,227,315 D344E probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70242485 missense probably benign
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGCTCCAAAACTGATGGAGGACC -3'
(R):5'- AGATTGCCACATGGAGGCTCTGAC -3'

Sequencing Primer
(F):5'- TATTGCGAAGTCCCAGGTTC -3'
(R):5'- tcagtcccggagaggttaag -3'
Posted On2013-06-11