Incidental Mutation 'R5835:Habp2'
ID449574
Institutional Source Beutler Lab
Gene Symbol Habp2
Ensembl Gene ENSMUSG00000025075
Gene Namehyaluronic acid binding protein 2
SynonymsFSAP
MMRRC Submission 044056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5835 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56287137-56320822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56306786 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 36 (D36E)
Ref Sequence ENSEMBL: ENSMUSP00000126235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078284] [ENSMUST00000095948] [ENSMUST00000166049] [ENSMUST00000171341]
Predicted Effect probably benign
Transcript: ENSMUST00000078284
AA Change: D36E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000077402
Gene: ENSMUSG00000025075
AA Change: D36E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 307 544 1.47e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095948
SMART Domains Protein: ENSMUSP00000093641
Gene: ENSMUSG00000025075

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 33 66 4.66e-6 SMART
EGF 71 105 3.97e0 SMART
EGF 110 145 2.26e-4 SMART
KR 149 235 2.72e-39 SMART
Tryp_SPc 270 507 1.47e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165407
Predicted Effect probably benign
Transcript: ENSMUST00000166049
AA Change: D36E

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132444
Gene: ENSMUSG00000025075
AA Change: D36E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Tryp_SPc 302 539 1.47e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171341
AA Change: D36E

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126235
Gene: ENSMUSG00000025075
AA Change: D36E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
EGF 70 103 4.66e-6 SMART
EGF 108 142 3.97e0 SMART
EGF 147 182 2.26e-4 SMART
KR 186 272 2.72e-39 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is secreted by hepatocytes and proteolytically processed to generate heavy and light chains that form the mature heterodimer. Further autoproteolysis leads to smaller, inactive peptides. This extracellular protease binds hyaluronic acid and may play a role in the coagulation and fibrinolysis systems. Mutations in this gene are associated with nonmedullary thyroid cancer and susceptibility to venous thromboembolism. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased lethality but increased liver fibrosis, inflammation and injury following bile duct ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2m A G 6: 121,639,336 K141R probably damaging Het
Ablim3 T C 18: 61,823,922 E278G probably damaging Het
Adam28 A G 14: 68,655,681 W4R possibly damaging Het
Ahnak2 T C 12: 112,775,796 N614S possibly damaging Het
Arfgef1 A G 1: 10,160,739 S1182P probably damaging Het
Asb8 A T 15: 98,136,382 D97E probably damaging Het
AU041133 T A 10: 82,151,212 L232H probably damaging Het
Bmp2k T G 5: 97,056,982 V392G possibly damaging Het
Capn12 C A 7: 28,881,958 H79N probably benign Het
Casp2 C A 6: 42,267,586 S54R possibly damaging Het
Ccdc18 T C 5: 108,140,874 S163P possibly damaging Het
Ccdc92b A G 11: 74,638,012 E114G probably benign Het
Cd209c C A 8: 3,945,699 M34I probably benign Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cndp1 C A 18: 84,612,833 A434S probably benign Het
Crybg1 T A 10: 43,975,133 T1581S probably benign Het
Cyb5d2 A T 11: 72,789,210 D86E probably damaging Het
Duox1 T G 2: 122,327,860 V608G probably benign Het
Exosc10 A G 4: 148,565,387 R425G probably damaging Het
Fat3 A T 9: 16,375,833 I798N probably damaging Het
Herpud1 T C 8: 94,392,239 V207A probably damaging Het
Htt A G 5: 34,813,190 I561V probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igkv18-36 A G 6: 69,992,528 I93T probably damaging Het
Kalrn T G 16: 33,987,091 E2636A probably benign Het
Kif27 A G 13: 58,313,146 probably null Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Myh6 T C 14: 54,950,407 K1197E probably damaging Het
Obscn T C 11: 59,002,081 T6780A probably benign Het
Obscn C T 11: 59,042,127 V4808M probably damaging Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Pkhd1 T C 1: 20,201,083 D3082G probably benign Het
Plch1 T C 3: 63,697,522 M1645V probably benign Het
Ppip5k1 A G 2: 121,337,899 V674A probably benign Het
Prrc2b T A 2: 32,206,473 S619T probably benign Het
Rab44 A T 17: 29,148,238 H714L probably benign Het
Rybp A G 6: 100,233,190 Y70H possibly damaging Het
Sfrp1 A G 8: 23,446,244 K234R possibly damaging Het
Slc1a2 A G 2: 102,777,450 N481S probably damaging Het
Slc44a3 T G 3: 121,527,200 I51L probably benign Het
Slitrk1 A G 14: 108,911,572 F569S possibly damaging Het
Smurf2 A T 11: 106,836,148 N451K probably damaging Het
Sptbn2 T A 19: 4,738,219 D1075E probably damaging Het
Syngap1 A T 17: 26,958,218 H65L probably benign Het
Tdrd12 T C 7: 35,529,264 D11G probably damaging Het
Tex2 C T 11: 106,519,913 A926T unknown Het
Tm7sf2 A G 19: 6,063,884 F209S probably damaging Het
Trbv12-2 G A 6: 41,118,840 probably benign Het
Virma T A 4: 11,514,036 L630H probably damaging Het
Vmn1r68 A G 7: 10,527,820 I117T possibly damaging Het
Zan C A 5: 137,456,655 R1373L unknown Het
Other mutations in Habp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Habp2 APN 19 56317832 missense probably damaging 1.00
IGL01113:Habp2 APN 19 56310116 missense probably benign 0.13
IGL01737:Habp2 APN 19 56316307 missense probably benign 0.00
IGL02174:Habp2 APN 19 56311737 missense probably damaging 0.96
IGL02250:Habp2 APN 19 56308929 missense probably benign 0.00
IGL02706:Habp2 APN 19 56310138 critical splice donor site probably null
IGL02953:Habp2 APN 19 56314232 critical splice donor site probably null
IGL02986:Habp2 APN 19 56311192 missense probably benign 0.25
IGL03010:Habp2 APN 19 56311223 critical splice donor site probably null
R0415:Habp2 UTSW 19 56317717 unclassified probably benign
R0483:Habp2 UTSW 19 56316432 unclassified probably benign
R0627:Habp2 UTSW 19 56314046 missense probably damaging 1.00
R1188:Habp2 UTSW 19 56311722 missense probably benign 0.39
R1880:Habp2 UTSW 19 56317828 missense possibly damaging 0.83
R2214:Habp2 UTSW 19 56317817 missense possibly damaging 0.88
R2473:Habp2 UTSW 19 56288032 missense possibly damaging 0.92
R2869:Habp2 UTSW 19 56287991 unclassified probably benign
R2871:Habp2 UTSW 19 56287991 unclassified probably benign
R3917:Habp2 UTSW 19 56311179 missense probably damaging 1.00
R3969:Habp2 UTSW 19 56311701 missense probably damaging 1.00
R4014:Habp2 UTSW 19 56319622 missense probably benign 0.04
R4853:Habp2 UTSW 19 56311191 unclassified probably null
R6270:Habp2 UTSW 19 56306863 missense possibly damaging 0.93
R6390:Habp2 UTSW 19 56306823 missense possibly damaging 0.63
R7110:Habp2 UTSW 19 56311164 nonsense probably null
R7268:Habp2 UTSW 19 56314086 missense probably damaging 1.00
R7456:Habp2 UTSW 19 56319525 missense probably damaging 1.00
R7583:Habp2 UTSW 19 56311804 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAAACACCAGTAATGCTTTGGAG -3'
(R):5'- GGAGAGAAAAGCCCTTGCAC -3'

Sequencing Primer
(F):5'- GCTTTGGAGGACCATAATATCTCC -3'
(R):5'- AAGCCCTTGCACATGGC -3'
Posted On2016-12-20