Incidental Mutation 'R5836:Lrp3'
ID449591
Institutional Source Beutler Lab
Gene Symbol Lrp3
Ensembl Gene ENSMUSG00000001802
Gene Namelow density lipoprotein receptor-related protein 3
Synonyms
MMRRC Submission 043222-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5836 (G1)
Quality Score160
Status Not validated
Chromosome7
Chromosomal Location35200027-35215498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35203322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 533 (V533A)
Ref Sequence ENSEMBL: ENSMUSP00000114026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048]
Predicted Effect probably benign
Transcript: ENSMUST00000001854
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118444
AA Change: V512A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802
AA Change: V512A

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122409
AA Change: V533A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802
AA Change: V533A

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131048
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155404
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G T 17: 35,962,026 A243D possibly damaging Het
Azin2 C T 4: 128,948,877 G128D probably damaging Het
Babam1 A G 8: 71,403,043 E260G probably benign Het
Brwd1 A T 16: 96,064,758 S275T probably damaging Het
Cd8a T C 6: 71,373,791 V80A possibly damaging Het
Clec4a3 T C 6: 122,952,902 F12S possibly damaging Het
Dnah5 A C 15: 28,383,592 N2987H probably damaging Het
Dock9 A G 14: 121,681,351 F78S probably damaging Het
Eml3 A G 19: 8,941,295 T885A possibly damaging Het
Esr1 T C 10: 4,712,817 V145A probably benign Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gpr179 T C 11: 97,339,056 S758G probably benign Het
Heatr1 T A 13: 12,408,736 L538Q probably damaging Het
Ikzf2 A G 1: 69,539,387 I176T probably damaging Het
Nkx2-5 A T 17: 26,839,089 V297E possibly damaging Het
Olfr1388 T C 11: 49,444,526 L225P probably damaging Het
Olfr525 G A 7: 140,322,914 V72I probably benign Het
Olfr937 T C 9: 39,060,622 T15A probably benign Het
Pclo T A 5: 14,678,535 probably benign Het
Pdgfra T C 5: 75,163,774 W97R possibly damaging Het
Plekha5 T C 6: 140,426,524 Y67H probably damaging Het
Plin5 A T 17: 56,115,549 probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prickle1 T A 15: 93,503,017 K529* probably null Het
Ptbp2 G A 3: 119,726,097 T107I probably damaging Het
Ptpn12 C T 5: 21,009,546 W197* probably null Het
Rhobtb1 T C 10: 69,269,989 V128A probably damaging Het
Ryr2 T C 13: 11,603,732 T3866A probably damaging Het
Serpina3m T C 12: 104,389,250 Y59H probably damaging Het
Slc12a6 T C 2: 112,341,998 V414A possibly damaging Het
Slc34a1 T C 13: 55,413,465 M581T probably benign Het
Slco1c1 A G 6: 141,569,314 Y596C probably damaging Het
St5 A T 7: 109,541,345 S225T possibly damaging Het
Stoml1 T C 9: 58,260,840 L278P probably benign Het
Tecpr2 C T 12: 110,931,511 A399V possibly damaging Het
Tmem229a T C 6: 24,955,017 E246G probably damaging Het
Vmn1r224 A T 17: 20,419,691 I177L probably benign Het
Zswim5 C T 4: 116,984,803 T860I probably benign Het
Other mutations in Lrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Lrp3 APN 7 35206028 splice site probably benign
IGL01714:Lrp3 APN 7 35206071 unclassified probably null
IGL03033:Lrp3 APN 7 35202627 missense possibly damaging 0.61
IGL03166:Lrp3 APN 7 35202480 missense probably benign 0.00
Blackball UTSW 7 35206052 missense probably damaging 1.00
lowball UTSW 7 35204168 missense probably benign 0.00
PIT4434001:Lrp3 UTSW 7 35203995 missense probably damaging 0.99
R0416:Lrp3 UTSW 7 35202353 missense probably benign
R0733:Lrp3 UTSW 7 35202120 missense possibly damaging 0.93
R0907:Lrp3 UTSW 7 35203293 missense probably damaging 0.99
R1437:Lrp3 UTSW 7 35213170 missense probably damaging 1.00
R1591:Lrp3 UTSW 7 35202365 missense probably benign 0.03
R1625:Lrp3 UTSW 7 35203925 missense probably damaging 1.00
R1703:Lrp3 UTSW 7 35213161 missense possibly damaging 0.95
R3976:Lrp3 UTSW 7 35204105 missense probably benign 0.06
R4196:Lrp3 UTSW 7 35203410 missense probably damaging 1.00
R4679:Lrp3 UTSW 7 35203940 missense probably damaging 1.00
R5686:Lrp3 UTSW 7 35203485 missense possibly damaging 0.84
R6160:Lrp3 UTSW 7 35204123 missense possibly damaging 0.79
R6342:Lrp3 UTSW 7 35202306 missense probably benign 0.01
R6364:Lrp3 UTSW 7 35203709 missense probably benign 0.03
R6415:Lrp3 UTSW 7 35204168 missense probably benign 0.00
R6502:Lrp3 UTSW 7 35203988 missense possibly damaging 0.89
R6747:Lrp3 UTSW 7 35211437 missense probably benign
R7205:Lrp3 UTSW 7 35202626 missense probably damaging 0.99
R7232:Lrp3 UTSW 7 35206052 missense probably damaging 1.00
R7522:Lrp3 UTSW 7 35204330 missense probably damaging 0.99
R7870:Lrp3 UTSW 7 35211497 missense probably damaging 0.99
R7953:Lrp3 UTSW 7 35211497 missense probably damaging 0.99
Z1177:Lrp3 UTSW 7 35203012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTCAAAGGCCCTGAAAGC -3'
(R):5'- AGAACTGCTTTTCCTGCCAGC -3'

Sequencing Primer
(F):5'- TCCAGACCCCTGCATGC -3'
(R):5'- CTGTGCATCTTTGAGACG -3'
Posted On2016-12-20