Incidental Mutation 'R5836:Heatr1'
ID449608
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene NameHEAT repeat containing 1
SynonymsB130016L12Rik
MMRRC Submission 043222-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5836 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location12395027-12440289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12408736 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 538 (L538Q)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000221046]
Predicted Effect probably damaging
Transcript: ENSMUST00000059270
AA Change: L538Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: L538Q

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221746
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G T 17: 35,962,026 A243D possibly damaging Het
Azin2 C T 4: 128,948,877 G128D probably damaging Het
Babam1 A G 8: 71,403,043 E260G probably benign Het
Brwd1 A T 16: 96,064,758 S275T probably damaging Het
Cd8a T C 6: 71,373,791 V80A possibly damaging Het
Clec4a3 T C 6: 122,952,902 F12S possibly damaging Het
Dnah5 A C 15: 28,383,592 N2987H probably damaging Het
Dock9 A G 14: 121,681,351 F78S probably damaging Het
Eml3 A G 19: 8,941,295 T885A possibly damaging Het
Esr1 T C 10: 4,712,817 V145A probably benign Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gpr179 T C 11: 97,339,056 S758G probably benign Het
Ikzf2 A G 1: 69,539,387 I176T probably damaging Het
Lrp3 A G 7: 35,203,322 V533A probably damaging Het
Nkx2-5 A T 17: 26,839,089 V297E possibly damaging Het
Olfr1388 T C 11: 49,444,526 L225P probably damaging Het
Olfr525 G A 7: 140,322,914 V72I probably benign Het
Olfr937 T C 9: 39,060,622 T15A probably benign Het
Pclo T A 5: 14,678,535 probably benign Het
Pdgfra T C 5: 75,163,774 W97R possibly damaging Het
Plekha5 T C 6: 140,426,524 Y67H probably damaging Het
Plin5 A T 17: 56,115,549 probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prickle1 T A 15: 93,503,017 K529* probably null Het
Ptbp2 G A 3: 119,726,097 T107I probably damaging Het
Ptpn12 C T 5: 21,009,546 W197* probably null Het
Rhobtb1 T C 10: 69,269,989 V128A probably damaging Het
Ryr2 T C 13: 11,603,732 T3866A probably damaging Het
Serpina3m T C 12: 104,389,250 Y59H probably damaging Het
Slc12a6 T C 2: 112,341,998 V414A possibly damaging Het
Slc34a1 T C 13: 55,413,465 M581T probably benign Het
Slco1c1 A G 6: 141,569,314 Y596C probably damaging Het
St5 A T 7: 109,541,345 S225T possibly damaging Het
Stoml1 T C 9: 58,260,840 L278P probably benign Het
Tecpr2 C T 12: 110,931,511 A399V possibly damaging Het
Tmem229a T C 6: 24,955,017 E246G probably damaging Het
Vmn1r224 A T 17: 20,419,691 I177L probably benign Het
Zswim5 C T 4: 116,984,803 T860I probably benign Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12410450 missense probably benign 0.00
IGL00863:Heatr1 APN 13 12435128 missense probably benign 0.02
IGL00899:Heatr1 APN 13 12435176 missense probably benign 0.31
IGL01147:Heatr1 APN 13 12437912 missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12399027 missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12398938 missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12413528 missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12429799 missense probably benign
IGL02803:Heatr1 APN 13 12433986 missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12426212 missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12416059 missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12434411 missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12407509 unclassified probably benign
IGL03035:Heatr1 APN 13 12413219 splice site probably benign
IGL03301:Heatr1 APN 13 12434205 missense probably damaging 1.00
hasan UTSW 13 12417447 splice site probably benign
H8562:Heatr1 UTSW 13 12408713 missense probably benign 0.13
R0226:Heatr1 UTSW 13 12410562 missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12430240 missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12406037 missense probably benign 0.14
R1264:Heatr1 UTSW 13 12424610 unclassified probably benign
R1371:Heatr1 UTSW 13 12417632 missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12417447 splice site probably benign
R1396:Heatr1 UTSW 13 12406046 missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12412159 missense probably benign
R1689:Heatr1 UTSW 13 12424625 missense probably benign 0.00
R1696:Heatr1 UTSW 13 12423721 missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12396460 missense probably benign 0.01
R1859:Heatr1 UTSW 13 12403159 missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12435185 missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12396538 missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12414478 missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12412058 missense probably benign 0.03
R2119:Heatr1 UTSW 13 12432646 missense probably null 1.00
R2121:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2122:Heatr1 UTSW 13 12403264 missense probably benign 0.10
R2367:Heatr1 UTSW 13 12433724 missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12413348 missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12434460 missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12435121 missense probably benign 0.00
R4533:Heatr1 UTSW 13 12434511 missense probably benign 0.05
R4725:Heatr1 UTSW 13 12424662 nonsense probably null
R4763:Heatr1 UTSW 13 12430930 missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12431837 missense probably benign 0.00
R4797:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4798:Heatr1 UTSW 13 12412048 missense probably benign 0.36
R4942:Heatr1 UTSW 13 12413510 critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12410599 missense probably benign 0.38
R4954:Heatr1 UTSW 13 12407516 critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12401522 missense probably benign 0.02
R5464:Heatr1 UTSW 13 12433643 missense probably benign 0.00
R5483:Heatr1 UTSW 13 12398914 missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12421064 missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12406619 missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12402760 missense probably damaging 1.00
R5527:Heatr1 UTSW 13 12404948 missense probably benign
R5916:Heatr1 UTSW 13 12434471 missense probably damaging 1.00
R6018:Heatr1 UTSW 13 12404947 missense probably benign
R6018:Heatr1 UTSW 13 12406058 missense probably benign 0.26
R6216:Heatr1 UTSW 13 12432664 missense probably benign 0.16
R6396:Heatr1 UTSW 13 12406097 missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12434230 missense probably benign 0.29
R6922:Heatr1 UTSW 13 12435075 missense probably benign 0.00
R7077:Heatr1 UTSW 13 12418164 missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12421060 nonsense probably null
R7445:Heatr1 UTSW 13 12431038 missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12411262 missense probably benign 0.33
R7672:Heatr1 UTSW 13 12438664 missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12417641 missense probably benign 0.03
RF011:Heatr1 UTSW 13 12407544 missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12399008 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAGAAGGCCTGGTGTTGATG -3'
(R):5'- GCAATCTAACTACCCCTGTGAG -3'

Sequencing Primer
(F):5'- TGTTCTCAGAGCTGGGCC -3'
(R):5'- TGTGAGACTCATCACCAGACTTAAG -3'
Posted On2016-12-20