Incidental Mutation 'R5836:Dock9'
ID 449610
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission 043222-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5836 (G1)
Quality Score 201
Status Not validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121681351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 78 (F78S)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: F78S

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: F78S

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: F80S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: F80S

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: F78S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212376
AA Change: F92S

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 G T 17: 35,962,026 A243D possibly damaging Het
Azin2 C T 4: 128,948,877 G128D probably damaging Het
Babam1 A G 8: 71,403,043 E260G probably benign Het
Brwd1 A T 16: 96,064,758 S275T probably damaging Het
Cd8a T C 6: 71,373,791 V80A possibly damaging Het
Clec4a3 T C 6: 122,952,902 F12S possibly damaging Het
Dnah5 A C 15: 28,383,592 N2987H probably damaging Het
Eml3 A G 19: 8,941,295 T885A possibly damaging Het
Esr1 T C 10: 4,712,817 V145A probably benign Het
Gm5108 A G 5: 67,944,610 probably benign Het
Gpr179 T C 11: 97,339,056 S758G probably benign Het
Heatr1 T A 13: 12,408,736 L538Q probably damaging Het
Ikzf2 A G 1: 69,539,387 I176T probably damaging Het
Lrp3 A G 7: 35,203,322 V533A probably damaging Het
Nkx2-5 A T 17: 26,839,089 V297E possibly damaging Het
Olfr1388 T C 11: 49,444,526 L225P probably damaging Het
Olfr525 G A 7: 140,322,914 V72I probably benign Het
Olfr937 T C 9: 39,060,622 T15A probably benign Het
Pclo T A 5: 14,678,535 probably benign Het
Pdgfra T C 5: 75,163,774 W97R possibly damaging Het
Plekha5 T C 6: 140,426,524 Y67H probably damaging Het
Plin5 A T 17: 56,115,549 probably null Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Prickle1 T A 15: 93,503,017 K529* probably null Het
Ptbp2 G A 3: 119,726,097 T107I probably damaging Het
Ptpn12 C T 5: 21,009,546 W197* probably null Het
Rhobtb1 T C 10: 69,269,989 V128A probably damaging Het
Ryr2 T C 13: 11,603,732 T3866A probably damaging Het
Serpina3m T C 12: 104,389,250 Y59H probably damaging Het
Slc12a6 T C 2: 112,341,998 V414A possibly damaging Het
Slc34a1 T C 13: 55,413,465 M581T probably benign Het
Slco1c1 A G 6: 141,569,314 Y596C probably damaging Het
St5 A T 7: 109,541,345 S225T possibly damaging Het
Stoml1 T C 9: 58,260,840 L278P probably benign Het
Tecpr2 C T 12: 110,931,511 A399V possibly damaging Het
Tmem229a T C 6: 24,955,017 E246G probably damaging Het
Vmn1r224 A T 17: 20,419,691 I177L probably benign Het
Zswim5 C T 4: 116,984,803 T860I probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCATGCCTACCAGGTAG -3'
(R):5'- GTGAGACTTGTGAGATCGTCTC -3'

Sequencing Primer
(F):5'- TTCTCCAGGTAGCTAGGAATACAG -3'
(R):5'- TCTCACACAGACGGAGGTC -3'
Posted On 2016-12-20