Incidental Mutation 'R5837:Ncoa2'
ID449620
Institutional Source Beutler Lab
Gene Symbol Ncoa2
Ensembl Gene ENSMUSG00000005886
Gene Namenuclear receptor coactivator 2
SynonymsSRC-2, TIF2, glucocorticoid receptor-interacting protein 1, D1Ertd433e, KAT13C, bHLHe75, TIF2/GRIP-1, TIF-2, Grip1
MMRRC Submission 044057-MU
Accession Numbers

Ncbi RefSeq: NM_008678.2, NM_001077695.1; MGI: 1276533

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5837 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location13139105-13374083 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 13224706 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006037] [ENSMUST00000068304] [ENSMUST00000081713] [ENSMUST00000145280]
Predicted Effect probably benign
Transcript: ENSMUST00000006037
SMART Domains Protein: ENSMUSP00000006037
Gene: ENSMUSG00000005886

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:NCOA_u2 463 587 6.7e-39 PFAM
Pfam:SRC-1 636 709 5.8e-23 PFAM
Pfam:DUF4927 731 816 2.7e-33 PFAM
low complexity region 1021 1037 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1071 1117 6.5e-27 PFAM
low complexity region 1183 1204 N/A INTRINSIC
low complexity region 1243 1264 N/A INTRINSIC
DUF1518 1279 1336 5.92e-28 SMART
low complexity region 1409 1420 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068304
SMART Domains Protein: ENSMUSP00000069509
Gene: ENSMUSG00000005886

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081713
SMART Domains Protein: ENSMUSP00000080413
Gene: ENSMUSG00000005886

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
PAS 114 181 4.52e-9 SMART
PAC 334 377 1.13e0 SMART
low complexity region 434 447 N/A INTRINSIC
Pfam:SRC-1 636 709 2.2e-28 PFAM
low complexity region 802 813 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1002 1048 1.3e-25 PFAM
low complexity region 1114 1135 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
DUF1518 1210 1267 5.92e-28 SMART
low complexity region 1340 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143603
Predicted Effect probably benign
Transcript: ENSMUST00000145280
SMART Domains Protein: ENSMUSP00000116641
Gene: ENSMUSG00000005886

DomainStartEndE-ValueType
HLH 32 89 2.25e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147927
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype Strain: 2183803
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions as a transcriptional coactivator for nuclear hormone receptors, including steroid, thyroid, retinoid, and vitamin D receptors. The encoded protein acts as an intermediary factor for the ligand-dependent activity of these nuclear receptors, which regulate their target genes upon binding of cognate response elements. This gene has been found to be involved in translocations that result in fusions with other genes in various cancers, including the lysine acetyltransferase 6A (KAT6A) gene in acute myeloid leukemia, the ETS variant 6 (ETV6) gene in acute lymphoblastic leukemia, and the hes related family bHLH transcription factor with YRPW motif 1 (HEY1) gene in mesenchymal chondrosarcoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice exhibit a transient postnatal growth deficiency and hypofertility. Male hypofertility is due to defects in spermiogenesis and an age-dependent testicular degeneration preceded by defective lipid metabolism in Sertoli cells. Female hypofertility is due to a placental hypoplasia. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted(4) Gene trapped(39)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Ncoa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Ncoa2 APN 1 13149079 missense possibly damaging 0.91
IGL01469:Ncoa2 APN 1 13186869 missense probably benign 0.02
IGL01735:Ncoa2 APN 1 13164903 missense probably benign 0.01
IGL01799:Ncoa2 APN 1 13152375 splice site probably benign
IGL02023:Ncoa2 APN 1 13174854 missense probably damaging 1.00
IGL02115:Ncoa2 APN 1 13152817 missense probably damaging 1.00
IGL02263:Ncoa2 APN 1 13174763 missense probably damaging 1.00
IGL03131:Ncoa2 APN 1 13177174 missense probably damaging 0.98
IGL03189:Ncoa2 APN 1 13190136 missense probably damaging 1.00
IGL03240:Ncoa2 APN 1 13177092 missense probably damaging 1.00
R0017:Ncoa2 UTSW 1 13174752 missense probably damaging 1.00
R0056:Ncoa2 UTSW 1 117516497 critical splice donor site probably null
R0158:Ncoa2 UTSW 1 13152384 missense probably benign 0.05
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0164:Ncoa2 UTSW 1 13186731 critical splice donor site probably null
R0684:Ncoa2 UTSW 1 13224651 missense probably damaging 0.99
R0788:Ncoa2 UTSW 1 13166889 splice site probably benign
R1433:Ncoa2 UTSW 1 13148378 missense probably benign 0.01
R1517:Ncoa2 UTSW 1 13165057 missense probably benign 0.33
R1799:Ncoa2 UTSW 1 13162293 splice site probably null
R1959:Ncoa2 UTSW 1 13160252 missense probably damaging 1.00
R2034:Ncoa2 UTSW 1 13164983 missense probably benign 0.00
R2175:Ncoa2 UTSW 1 13224613 missense probably damaging 0.96
R2437:Ncoa2 UTSW 1 13148360 missense probably damaging 0.98
R2851:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R2853:Ncoa2 UTSW 1 13186889 missense probably damaging 1.00
R4334:Ncoa2 UTSW 1 13174963 missense possibly damaging 0.77
R4365:Ncoa2 UTSW 1 13180547 missense probably damaging 0.96
R4386:Ncoa2 UTSW 1 13177165 missense probably damaging 0.99
R4516:Ncoa2 UTSW 1 13146906 missense probably damaging 0.99
R5109:Ncoa2 UTSW 1 13186846 missense probably damaging 1.00
R5162:Ncoa2 UTSW 1 13175172 missense possibly damaging 0.79
R5183:Ncoa2 UTSW 1 13174366 missense probably damaging 1.00
R5250:Ncoa2 UTSW 1 13224689 missense probably damaging 1.00
R5514:Ncoa2 UTSW 1 13181221 missense probably damaging 1.00
R5691:Ncoa2 UTSW 1 13180550 missense probably damaging 0.99
R6003:Ncoa2 UTSW 1 13167030 missense possibly damaging 0.81
R6134:Ncoa2 UTSW 1 13174371 missense probably damaging 1.00
R6559:Ncoa2 UTSW 1 13150617 intron probably null
R6623:Ncoa2 UTSW 1 13181297 missense probably damaging 0.99
R6949:Ncoa2 UTSW 1 13156501 missense possibly damaging 0.92
R7090:Ncoa2 UTSW 1 13186838 missense probably damaging 1.00
R7251:Ncoa2 UTSW 1 13148375 missense probably benign 0.01
R7389:Ncoa2 UTSW 1 13186825 missense possibly damaging 0.62
R7565:Ncoa2 UTSW 1 13148376 missense probably benign 0.03
X0063:Ncoa2 UTSW 1 13175238 missense possibly damaging 0.82
X0066:Ncoa2 UTSW 1 13148449 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTGAAATCAGAACTGCCATTATG -3'
(R):5'- GCTCTTGCTTAGCCTTTAAGTG -3'

Sequencing Primer
(F):5'- CAACTGAATTGAATACTTCATGCCAC -3'
(R):5'- CTTAGCCTTTAAGTGTGCATTTATGC -3'
Posted On2016-12-20