Incidental Mutation 'R5837:Rabgap1l'
ID449623
Institutional Source Beutler Lab
Gene Symbol Rabgap1l
Ensembl Gene ENSMUSG00000026721
Gene NameRAB GTPase activating protein 1-like
SynonymsHh1, 8430421H08Rik, 5830411O09Rik, 9630005B12Rik
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5837 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160219174-160793211 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 160307222 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028049] [ENSMUST00000028052] [ENSMUST00000191651]
Predicted Effect probably benign
Transcript: ENSMUST00000028049
SMART Domains Protein: ENSMUSP00000028049
Gene: ENSMUSG00000026721

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
PTB 127 260 4.47e-20 SMART
Pfam:DUF3694 290 421 8.1e-41 PFAM
low complexity region 483 496 N/A INTRINSIC
TBC 535 747 5.13e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028052
SMART Domains Protein: ENSMUSP00000028052
Gene: ENSMUSG00000026721

DomainStartEndE-ValueType
Blast:TBC 54 100 8e-16 BLAST
PDB:3HZJ|C 54 130 9e-35 PDB
Blast:TBC 113 176 2e-24 BLAST
low complexity region 188 200 N/A INTRINSIC
coiled coil region 281 340 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191651
SMART Domains Protein: ENSMUSP00000141357
Gene: ENSMUSG00000026721

DomainStartEndE-ValueType
PDB:3HZJ|C 1 107 1e-71 PDB
SCOP:d1fkma2 1 107 1e-9 SMART
Blast:TBC 13 89 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191941
Predicted Effect unknown
Transcript: ENSMUST00000193185
AA Change: E39G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195114
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion are viable, fertile and overtly normal with no alterations in hematopoietic progenitor cell numbers or types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Rabgap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Rabgap1l APN 1 160738969 missense probably benign 0.02
IGL01309:Rabgap1l APN 1 160700798 missense probably benign 0.00
IGL01448:Rabgap1l APN 1 160740745 splice site probably benign
IGL01886:Rabgap1l APN 1 160342042 missense probably damaging 1.00
IGL02010:Rabgap1l APN 1 160472071 missense probably damaging 0.99
IGL02079:Rabgap1l APN 1 160738970 missense probably benign 0.00
IGL02800:Rabgap1l APN 1 160472053 missense possibly damaging 0.73
IGL03343:Rabgap1l APN 1 160443283 missense probably benign
IGL03388:Rabgap1l APN 1 160733523 splice site probably null
IGL03406:Rabgap1l APN 1 160722169 missense probably damaging 1.00
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0047:Rabgap1l UTSW 1 160231789 splice site probably benign
R0048:Rabgap1l UTSW 1 160627369 splice site probably benign
R0099:Rabgap1l UTSW 1 160682116 missense possibly damaging 0.89
R0201:Rabgap1l UTSW 1 160453745 splice site probably benign
R0432:Rabgap1l UTSW 1 160722205 missense probably benign 0.10
R1104:Rabgap1l UTSW 1 160231875 splice site probably benign
R1220:Rabgap1l UTSW 1 160738909 missense probably damaging 1.00
R1485:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R1569:Rabgap1l UTSW 1 160702390 missense probably benign 0.08
R1907:Rabgap1l UTSW 1 160645310 missense probably benign 0.07
R2128:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2129:Rabgap1l UTSW 1 160738957 missense probably benign 0.00
R2177:Rabgap1l UTSW 1 160724062 missense possibly damaging 0.89
R4636:Rabgap1l UTSW 1 160342090 synonymous probably null
R4722:Rabgap1l UTSW 1 160342164 missense possibly damaging 0.81
R4743:Rabgap1l UTSW 1 160453783 missense probably damaging 1.00
R4913:Rabgap1l UTSW 1 160238541 missense probably damaging 1.00
R4915:Rabgap1l UTSW 1 160441842 missense probably benign 0.01
R5035:Rabgap1l UTSW 1 160724036 missense probably damaging 1.00
R5087:Rabgap1l UTSW 1 160722239 missense probably damaging 1.00
R5437:Rabgap1l UTSW 1 160722147 missense probably damaging 1.00
R5507:Rabgap1l UTSW 1 160351328 missense possibly damaging 0.83
R5619:Rabgap1l UTSW 1 160238572 missense probably benign 0.00
R5691:Rabgap1l UTSW 1 160735684 missense probably damaging 1.00
R5881:Rabgap1l UTSW 1 160342113 missense probably damaging 1.00
R6045:Rabgap1l UTSW 1 160645323 missense probably benign 0.00
R6243:Rabgap1l UTSW 1 160645307 critical splice donor site probably null
R6294:Rabgap1l UTSW 1 160231849 missense probably benign 0.14
R6452:Rabgap1l UTSW 1 160453761 missense probably damaging 1.00
R6802:Rabgap1l UTSW 1 160733680 missense probably benign 0.06
R6945:Rabgap1l UTSW 1 160682182 missense probably benign 0.29
R7014:Rabgap1l UTSW 1 160342072 missense probably damaging 1.00
R7062:Rabgap1l UTSW 1 160226650 missense probably benign
R7089:Rabgap1l UTSW 1 160724172 nonsense probably null
R7170:Rabgap1l UTSW 1 160645365 missense probably damaging 1.00
R7172:Rabgap1l UTSW 1 160733586 missense probably benign 0.05
R7303:Rabgap1l UTSW 1 160682097 missense probably benign 0.01
R7357:Rabgap1l UTSW 1 160342038 missense probably damaging 1.00
R7466:Rabgap1l UTSW 1 160226484 critical splice donor site probably null
R7501:Rabgap1l UTSW 1 160700788 missense probably damaging 0.98
R7565:Rabgap1l UTSW 1 160251417 missense
R7582:Rabgap1l UTSW 1 160682084 missense probably benign
R7740:Rabgap1l UTSW 1 160682103 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATATTACCGACATAGAACAGTG -3'
(R):5'- TCTCAAGTGGGTGTGTGCAC -3'

Sequencing Primer
(F):5'- TGAAAGCCTGCAGACCTCG -3'
(R):5'- TGCACTGAGCTGCCCTAAGAC -3'
Posted On2016-12-20