Incidental Mutation 'R5837:Olfr376'
ID449661
Institutional Source Beutler Lab
Gene Symbol Olfr376
Ensembl Gene ENSMUSG00000063881
Gene Nameolfactory receptor 376
SynonymsGA_x6K02T2P1NL-3535075-3536028, MOR135-12
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5837 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73371246-73377836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73375648 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 300 (M300V)
Ref Sequence ENSEMBL: ENSMUSP00000126073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078952] [ENSMUST00000120401] [ENSMUST00000170592]
Predicted Effect probably benign
Transcript: ENSMUST00000078952
AA Change: M303V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077977
Gene: ENSMUSG00000063881
AA Change: M303V

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 7.4e-8 PFAM
Pfam:7tm_1 47 296 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120401
AA Change: M300V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113236
Gene: ENSMUSG00000063881
AA Change: M300V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170592
AA Change: M300V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126073
Gene: ENSMUSG00000063881
AA Change: M300V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 308 1.1e-7 PFAM
Pfam:7tm_1 44 293 7.2e-36 PFAM
Pfam:7tm_4 142 286 1.4e-46 PFAM
Meta Mutation Damage Score 0.1379 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Olfr376
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr376 APN 11 73375007 missense probably benign 0.03
IGL01462:Olfr376 APN 11 73374752 start codon destroyed probably null 0.02
IGL01725:Olfr376 APN 11 73375156 missense probably benign 0.39
IGL02225:Olfr376 APN 11 73375078 missense probably damaging 0.98
R0006:Olfr376 UTSW 11 73375588 missense possibly damaging 0.65
R0090:Olfr376 UTSW 11 73375576 missense probably benign 0.04
R0743:Olfr376 UTSW 11 73374889 missense probably benign 0.03
R0884:Olfr376 UTSW 11 73374889 missense probably benign 0.03
R1102:Olfr376 UTSW 11 73374874 missense probably benign 0.00
R1582:Olfr376 UTSW 11 73375264 missense probably damaging 1.00
R1765:Olfr376 UTSW 11 73375344 missense probably damaging 1.00
R1929:Olfr376 UTSW 11 73375601 missense probably damaging 1.00
R1941:Olfr376 UTSW 11 73375621 missense probably damaging 1.00
R4738:Olfr376 UTSW 11 73375350 missense possibly damaging 0.94
R4947:Olfr376 UTSW 11 73375417 nonsense probably null
R6440:Olfr376 UTSW 11 73375347 missense probably benign 0.06
R6736:Olfr376 UTSW 11 73375576 missense probably benign 0.18
R7254:Olfr376 UTSW 11 73375375 missense probably benign
R7354:Olfr376 UTSW 11 73375375 missense probably benign 0.01
R7437:Olfr376 UTSW 11 73375018 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGTAAAGCCTTCTCCACCTG -3'
(R):5'- CTTGTGTGAGATGCAGCTATTC -3'

Sequencing Primer
(F):5'- GTCCATCAGCTGATAACTCT -3'
(R):5'- GCAGCTATTCTAGTCATTAGTGC -3'
Posted On2016-12-20