Incidental Mutation 'R0548:Olfr437'
ID44967
Institutional Source Beutler Lab
Gene Symbol Olfr437
Ensembl Gene ENSMUSG00000071481
Gene Nameolfactory receptor 437
SynonymsGA_x6K02T2P3E9-4391088-4390156, MOR261-11
MMRRC Submission 038740-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R0548 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location43163282-43169861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43167187 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 43 (I43K)
Ref Sequence ENSEMBL: ENSMUSP00000145490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060243] [ENSMUST00000205175] [ENSMUST00000216179]
Predicted Effect probably benign
Transcript: ENSMUST00000060243
AA Change: I43K

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058147
Gene: ENSMUSG00000071481
AA Change: I43K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205175
AA Change: I43K

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145490
Gene: ENSMUSG00000071481
AA Change: I43K

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 7.5e-60 PFAM
Pfam:7tm_1 40 289 3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216179
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdk5rap2 A T 4: 70,349,142 probably null Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Map1b T C 13: 99,431,683 K1510R unknown Het
Marco T C 1: 120,492,038 T187A probably benign Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mmp15 T C 8: 95,372,351 V602A probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tars2 T C 3: 95,742,659 D470G probably damaging Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Wdr20rt T A 12: 65,227,315 D344E probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Olfr437
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Olfr437 APN 6 43167390 missense probably damaging 1.00
IGL01618:Olfr437 APN 6 43167703 missense probably damaging 0.97
IGL02426:Olfr437 APN 6 43167088 missense probably benign 0.02
R0856:Olfr437 UTSW 6 43167411 missense probably damaging 1.00
R1590:Olfr437 UTSW 6 43167912 missense probably damaging 1.00
R1902:Olfr437 UTSW 6 43167723 unclassified probably null
R3894:Olfr437 UTSW 6 43167258 missense probably benign 0.23
R5083:Olfr437 UTSW 6 43167339 missense probably benign 0.33
R5278:Olfr437 UTSW 6 43167721 missense probably damaging 1.00
R6246:Olfr437 UTSW 6 43167502 unclassified probably null
R6781:Olfr437 UTSW 6 43167388 missense probably damaging 1.00
R6807:Olfr437 UTSW 6 43167238 missense probably damaging 1.00
R7253:Olfr437 UTSW 6 43167810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTTCAGTCTCACATCACCAC -3'
(R):5'- GGACATGGCTGCCAAAATCAAGCAC -3'

Sequencing Primer
(F):5'- CTACACCAGCTCTCATATAGGAATGG -3'
(R):5'- GCCAAATACAAGAATGTCTGTGTG -3'
Posted On2013-06-11