Incidental Mutation 'R5837:Galnt6'
ID449673
Institutional Source Beutler Lab
Gene Symbol Galnt6
Ensembl Gene ENSMUSG00000037280
Gene Namepolypeptide N-acetylgalactosaminyltransferase 6
SynonymsGalNAc-T6
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5837 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100691813-100729376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100694646 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 560 (T560M)
Ref Sequence ENSEMBL: ENSMUSP00000124793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052069] [ENSMUST00000159715] [ENSMUST00000161514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052069
AA Change: T560M

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000056705
Gene: ENSMUSG00000037280
AA Change: T560M

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159715
AA Change: T560M

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123848
Gene: ENSMUSG00000037280
AA Change: T560M

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 432 1e-10 PFAM
Pfam:Glycos_transf_2 180 366 4.1e-31 PFAM
Pfam:Glyco_transf_7C 337 415 6.7e-13 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160960
Predicted Effect possibly damaging
Transcript: ENSMUST00000161514
AA Change: T560M

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124793
Gene: ENSMUSG00000037280
AA Change: T560M

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229410
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. The encoded protein is capable of glycosylating fibronectin peptide in vitro and is expressed in a fibroblast cell line, indicating that it may be involved in the synthesis of oncofetal fibronectin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Nolc1 T C 19: 46,083,183 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Galnt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Galnt6 APN 15 100703493 missense probably benign 0.16
IGL02606:Galnt6 APN 15 100714219 missense probably damaging 1.00
R0325:Galnt6 UTSW 15 100693471 splice site probably null
R0336:Galnt6 UTSW 15 100699206 missense probably damaging 0.99
R0504:Galnt6 UTSW 15 100696657 splice site probably benign
R1563:Galnt6 UTSW 15 100703378 missense probably benign 0.00
R1903:Galnt6 UTSW 15 100716118 missense possibly damaging 0.79
R2007:Galnt6 UTSW 15 100697166 missense probably damaging 1.00
R2114:Galnt6 UTSW 15 100714241 missense probably damaging 1.00
R2943:Galnt6 UTSW 15 100714279 splice site probably null
R3410:Galnt6 UTSW 15 100699137 missense probably damaging 1.00
R3954:Galnt6 UTSW 15 100697168 missense possibly damaging 0.72
R4754:Galnt6 UTSW 15 100699224 missense probably damaging 1.00
R4910:Galnt6 UTSW 15 100716178 missense probably benign
R4911:Galnt6 UTSW 15 100716178 missense probably benign
R4962:Galnt6 UTSW 15 100696574 nonsense probably null
R5237:Galnt6 UTSW 15 100693393 missense probably damaging 1.00
R5293:Galnt6 UTSW 15 100703501 missense probably benign 0.00
R5605:Galnt6 UTSW 15 100697225 missense probably damaging 1.00
R5752:Galnt6 UTSW 15 100704126 missense probably damaging 1.00
R5949:Galnt6 UTSW 15 100696550 missense probably damaging 1.00
R6051:Galnt6 UTSW 15 100694668 missense probably damaging 1.00
R6306:Galnt6 UTSW 15 100693424 missense possibly damaging 0.70
R6522:Galnt6 UTSW 15 100693355 makesense probably null
R6959:Galnt6 UTSW 15 100714125 missense probably damaging 0.99
R7154:Galnt6 UTSW 15 100693464 missense probably benign 0.05
R7450:Galnt6 UTSW 15 100697815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAATCCCGTGGTGCTCA -3'
(R):5'- TGATACAAAGTCTTGGCACAGC -3'

Sequencing Primer
(F):5'- TGCTCAGGCAGAAGATGATG -3'
(R):5'- AAAGTCTTGGCACAGCTCCCTC -3'
Posted On2016-12-20