Mutagenetix > Incidental Mutations

Incidental Mutation 'R5837:Vmn2r116'

449678

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r116

Ensembl Gene

ENSMUSG00000090966

Gene Name

vomeronasal 2, receptor 116

Synonyms

V2Rp5, EG619697

MMRRC Submission

044057-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R5837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23384803-23401864 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23387080 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 322 (F322S)

Ref Sequence

ENSEMBL: ENSMUSP00000128106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164856]

Predicted Effect

probably damaging
Transcript: ENSMUST00000164856
AA Change: F322S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: F322S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	4.4e-30	PFAM
Pfam:NCD3G	511	564	1.2e-22	PFAM
low complexity region	589	594	N/A	INTRINSIC
Pfam:7tm_3	595	832	8.7e-57	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	G	A	2: 25,433,359	R113Q	probably benign	Het
Ank1	A	G	8: 23,104,790	N605D	probably damaging	Het
Apob	A	G	12: 8,003,277	M1240V	probably benign	Het
Atf1	T	A	15: 100,254,384	I86N	probably damaging	Het
Best1	T	A	19: 9,989,119		probably null	Het
Bet1l	C	A	7: 140,854,781	R51L	probably benign	Het
Bpifa5	A	G	2: 154,163,678	Y60C	probably damaging	Het
Ccdc141	G	T	2: 77,108,437	Q275K	possibly damaging	Het
Cep295	T	A	9: 15,346,984	H241L	probably damaging	Het
Commd7	A	G	2: 153,629,224	V36A	possibly damaging	Het
Cyld	G	A	8: 88,741,404	S555N	probably damaging	Het
Cyp2j13	A	T	4: 96,071,682	I79N	probably damaging	Het
Dact2	A	G	17: 14,196,253	S562P	probably damaging	Het
Diexf	A	T	1: 193,118,393	F373Y	probably damaging	Het
Dnajc13	T	A	9: 104,176,666	I1664F	possibly damaging	Het
Ehmt1	A	G	2: 24,863,914	V277A	probably damaging	Het
Fbn1	A	T	2: 125,379,134		probably null	Het
Galnt6	G	A	15: 100,694,646	T560M	possibly damaging	Het
Glra1	G	T	11: 55,536,507		probably null	Het
Gm10762	C	T	2: 128,967,157		probably benign	Het
Greb1	C	T	12: 16,688,585	R1459H	probably damaging	Het
Ift140	A	G	17: 25,089,540	K1048E	probably damaging	Het
Ilk	T	C	7: 105,741,171		probably null	Het
Lgi4	C	T	7: 31,070,783		probably benign	Het
Loxhd1	A	G	18: 77,286,409	T59A	possibly damaging	Het
Lzic	G	T	4: 149,486,000		probably null	Het
Mef2d	A	G	3: 88,161,781	T286A	probably benign	Het
Mycbp2	C	A	14: 103,124,403	C4447F	probably damaging	Het
Ncoa2	A	G	1: 13,224,706		probably benign	Het
Nolc1	T	C	19: 46,083,183		probably benign	Het
Npl	T	C	1: 153,503,525	T271A	probably benign	Het
Nudt1	A	G	5: 140,334,540	R25G	probably damaging	Het
Nudt19	T	C	7: 35,551,636	E226G	possibly damaging	Het
Oc90	T	C	15: 65,876,446	D405G	probably benign	Het
Olfr1111	A	T	2: 87,150,355	F102Y	probably benign	Het
Olfr1491	T	A	19: 13,704,960	C44*	probably null	Het
Olfr376	A	G	11: 73,375,648	M300V	probably benign	Het
Olfr826	A	T	10: 130,180,397	L161H	probably damaging	Het
Pcdhb1	T	C	18: 37,265,827	I277T	possibly damaging	Het
Pcdhb9	C	A	18: 37,402,798	A615E	probably damaging	Het
Phrf1	C	G	7: 141,260,061	D1056E	probably benign	Het
Phyhip	C	A	14: 70,467,010	A223E	probably damaging	Het
Polr2h	T	A	16: 20,717,932	I4N	probably damaging	Het
Ppp1r12c	C	A	7: 4,497,404		probably benign	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Psg17	T	A	7: 18,820,215	T37S	possibly damaging	Het
Ptprz1	T	C	6: 23,001,418	V1169A	probably benign	Het
Rabgap1l	T	C	1: 160,307,222		probably benign	Het
Rapgef3	C	T	15: 97,757,342		probably benign	Het
Rbp3	C	A	14: 33,954,273	H59Q	probably benign	Het
Robo3	T	A	9: 37,429,816		probably null	Het
Slco4c1	C	T	1: 96,818,982	E712K	probably benign	Het
Ssh3	T	C	19: 4,266,400	T168A	probably benign	Het
Stoml2	G	T	4: 43,028,989	N248K	probably damaging	Het
Tmigd1	A	G	11: 76,916,085		probably benign	Het
Tnc	T	A	4: 64,013,214	D753V	probably damaging	Het
Tnik	A	T	3: 28,668,053		probably benign	Het
Treml1	A	G	17: 48,360,152	S22G	possibly damaging	Het
Trmt2a	C	T	16: 18,249,462		probably benign	Het
Ttn	T	C	2: 76,717,374	T32151A	probably damaging	Het
Vmn1r67	T	C	7: 10,447,022	I10T	probably benign	Het
Wdr19	A	G	5: 65,202,957	D35G	probably benign	Het
Zfp365	A	T	10: 67,889,040	H339Q	probably damaging	Het
Zfp677	A	T	17: 21,397,386	H235L	probably damaging	Het
Zpbp2	G	A	11: 98,551,271		probably benign	Het

Other mutations in Vmn2r116

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Vmn2r116	APN	17	23385995	missense	possibly damaging	0.94
IGL00985:Vmn2r116	APN	17	23401515	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23397727	missense	probably damaging	1.00
IGL00990:Vmn2r116	APN	17	23387236	missense	probably benign	0.12
IGL01383:Vmn2r116	APN	17	23401601	missense	probably damaging	1.00
IGL01459:Vmn2r116	APN	17	23384929	missense	probably damaging	1.00
IGL01725:Vmn2r116	APN	17	23386645	missense	probably damaging	1.00
IGL02125:Vmn2r116	APN	17	23397627	splice site	probably benign
IGL02170:Vmn2r116	APN	17	23384933	missense	probably benign
IGL02209:Vmn2r116	APN	17	23388787	missense	probably damaging	1.00
IGL02226:Vmn2r116	APN	17	23384834	missense	probably null
IGL02272:Vmn2r116	APN	17	23385999	missense	probably benign	0.06
IGL02272:Vmn2r116	APN	17	23386004	missense	probably damaging	1.00
IGL02403:Vmn2r116	APN	17	23387364	missense	probably damaging	1.00
IGL02686:Vmn2r116	APN	17	23388793	missense	probably damaging	0.99
IGL02750:Vmn2r116	APN	17	23397634	splice site	probably benign
IGL02977:Vmn2r116	APN	17	23388774	missense	possibly damaging	0.90
PIT4449001:Vmn2r116	UTSW	17	23388947	missense	probably benign	0.41
R0015:Vmn2r116	UTSW	17	23401849	missense	probably benign	0.03
R0219:Vmn2r116	UTSW	17	23386098	nonsense	probably null
R0281:Vmn2r116	UTSW	17	23401413	missense	possibly damaging	0.90
R0415:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
R0592:Vmn2r116	UTSW	17	23386915	missense	probably damaging	0.99
R0610:Vmn2r116	UTSW	17	23387312	missense	probably damaging	1.00
R0635:Vmn2r116	UTSW	17	23386887	missense	possibly damaging	0.95
R0843:Vmn2r116	UTSW	17	23400960	missense	probably benign	0.01
R1329:Vmn2r116	UTSW	17	23387188	missense	possibly damaging	0.89
R1396:Vmn2r116	UTSW	17	23386141	missense	probably benign
R1401:Vmn2r116	UTSW	17	23386596	splice site	probably benign
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1574:Vmn2r116	UTSW	17	23387089	missense	probably damaging	0.99
R1766:Vmn2r116	UTSW	17	23401766	missense	probably damaging	0.98
R2157:Vmn2r116	UTSW	17	23401469	missense	probably damaging	1.00
R3622:Vmn2r116	UTSW	17	23386051	missense	probably benign	0.11
R3690:Vmn2r116	UTSW	17	23384824	missense	unknown
R4298:Vmn2r116	UTSW	17	23401827	missense	possibly damaging	0.69
R4373:Vmn2r116	UTSW	17	23401421	missense	probably benign	0.01
R4860:Vmn2r116	UTSW	17	23401803	missense	probably benign
R4941:Vmn2r116	UTSW	17	23401142	missense	probably damaging	1.00
R5119:Vmn2r116	UTSW	17	23387164	missense	probably benign	0.01
R5503:Vmn2r116	UTSW	17	23386804	missense	probably benign	0.07
R5510:Vmn2r116	UTSW	17	23386121	missense	probably damaging	1.00
R5538:Vmn2r116	UTSW	17	23401067	missense	probably benign	0.00
R5689:Vmn2r116	UTSW	17	23397719	missense	probably benign	0.30
R5765:Vmn2r116	UTSW	17	23401404	missense	probably damaging	0.99
R5794:Vmn2r116	UTSW	17	23385968	missense	probably damaging	0.99
R5807:Vmn2r116	UTSW	17	23387307	missense	probably damaging	1.00
R6262:Vmn2r116	UTSW	17	23387377	missense	probably benign	0.03
R6298:Vmn2r116	UTSW	17	23386762	missense	probably damaging	1.00
R6651:Vmn2r116	UTSW	17	23388831	nonsense	probably null
R6667:Vmn2r116	UTSW	17	23401092	missense	probably damaging	1.00
R7393:Vmn2r116	UTSW	17	23386125	missense	probably benign	0.14
R7571:Vmn2r116	UTSW	17	23384856	splice site	probably null
R7940:Vmn2r116	UTSW	17	23386972	missense	probably damaging	0.99
R8510:Vmn2r116	UTSW	17	23385931	nonsense	probably null
S24628:Vmn2r116	UTSW	17	23387279	missense	possibly damaging	0.55
Z1176:Vmn2r116	UTSW	17	23401428	missense	probably damaging	1.00
Z1177:Vmn2r116	UTSW	17	23388892	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAAGAGCTGAAGTGTATTACAACC -3'
(R):5'- GGCCATGTCAAAAGTATGTACC -3'

Sequencing Primer
(F):5'- GAGCTGAAGTGTATTACAACCAAATC -3'
(R):5'- TGTACCATTAACCATTTCAATGAGTG -3'

Posted On

2016-12-20