Incidental Mutation 'R5837:Nolc1'
ID449688
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Namenucleolar and coiled-body phosphoprotein 1
SynonymsNOPP140, 3230402K17Rik, P130
MMRRC Submission 044057-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5837 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46075863-46085530 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 46083183 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect unknown
Transcript: ENSMUST00000165017
AA Change: S524P
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176
AA Change: S524P

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000223683
AA Change: S523P
Predicted Effect unknown
Transcript: ENSMUST00000223728
AA Change: S522P
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect unknown
Transcript: ENSMUST00000225780
AA Change: S523P
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,433,359 R113Q probably benign Het
Ank1 A G 8: 23,104,790 N605D probably damaging Het
Apob A G 12: 8,003,277 M1240V probably benign Het
Atf1 T A 15: 100,254,384 I86N probably damaging Het
Best1 T A 19: 9,989,119 probably null Het
Bet1l C A 7: 140,854,781 R51L probably benign Het
Bpifa5 A G 2: 154,163,678 Y60C probably damaging Het
Ccdc141 G T 2: 77,108,437 Q275K possibly damaging Het
Cep295 T A 9: 15,346,984 H241L probably damaging Het
Commd7 A G 2: 153,629,224 V36A possibly damaging Het
Cyld G A 8: 88,741,404 S555N probably damaging Het
Cyp2j13 A T 4: 96,071,682 I79N probably damaging Het
Dact2 A G 17: 14,196,253 S562P probably damaging Het
Diexf A T 1: 193,118,393 F373Y probably damaging Het
Dnajc13 T A 9: 104,176,666 I1664F possibly damaging Het
Ehmt1 A G 2: 24,863,914 V277A probably damaging Het
Fbn1 A T 2: 125,379,134 probably null Het
Galnt6 G A 15: 100,694,646 T560M possibly damaging Het
Glra1 G T 11: 55,536,507 probably null Het
Gm10762 C T 2: 128,967,157 probably benign Het
Greb1 C T 12: 16,688,585 R1459H probably damaging Het
Ift140 A G 17: 25,089,540 K1048E probably damaging Het
Ilk T C 7: 105,741,171 probably null Het
Lgi4 C T 7: 31,070,783 probably benign Het
Loxhd1 A G 18: 77,286,409 T59A possibly damaging Het
Lzic G T 4: 149,486,000 probably null Het
Mef2d A G 3: 88,161,781 T286A probably benign Het
Mycbp2 C A 14: 103,124,403 C4447F probably damaging Het
Ncoa2 A G 1: 13,224,706 probably benign Het
Npl T C 1: 153,503,525 T271A probably benign Het
Nudt1 A G 5: 140,334,540 R25G probably damaging Het
Nudt19 T C 7: 35,551,636 E226G possibly damaging Het
Oc90 T C 15: 65,876,446 D405G probably benign Het
Olfr1111 A T 2: 87,150,355 F102Y probably benign Het
Olfr1491 T A 19: 13,704,960 C44* probably null Het
Olfr376 A G 11: 73,375,648 M300V probably benign Het
Olfr826 A T 10: 130,180,397 L161H probably damaging Het
Pcdhb1 T C 18: 37,265,827 I277T possibly damaging Het
Pcdhb9 C A 18: 37,402,798 A615E probably damaging Het
Phrf1 C G 7: 141,260,061 D1056E probably benign Het
Phyhip C A 14: 70,467,010 A223E probably damaging Het
Polr2h T A 16: 20,717,932 I4N probably damaging Het
Ppp1r12c C A 7: 4,497,404 probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Psg17 T A 7: 18,820,215 T37S possibly damaging Het
Ptprz1 T C 6: 23,001,418 V1169A probably benign Het
Rabgap1l T C 1: 160,307,222 probably benign Het
Rapgef3 C T 15: 97,757,342 probably benign Het
Rbp3 C A 14: 33,954,273 H59Q probably benign Het
Robo3 T A 9: 37,429,816 probably null Het
Slco4c1 C T 1: 96,818,982 E712K probably benign Het
Ssh3 T C 19: 4,266,400 T168A probably benign Het
Stoml2 G T 4: 43,028,989 N248K probably damaging Het
Tmigd1 A G 11: 76,916,085 probably benign Het
Tnc T A 4: 64,013,214 D753V probably damaging Het
Tnik A T 3: 28,668,053 probably benign Het
Treml1 A G 17: 48,360,152 S22G possibly damaging Het
Trmt2a C T 16: 18,249,462 probably benign Het
Ttn T C 2: 76,717,374 T32151A probably damaging Het
Vmn1r67 T C 7: 10,447,022 I10T probably benign Het
Vmn2r116 T C 17: 23,387,080 F322S probably damaging Het
Wdr19 A G 5: 65,202,957 D35G probably benign Het
Zfp365 A T 10: 67,889,040 H339Q probably damaging Het
Zfp677 A T 17: 21,397,386 H235L probably damaging Het
Zpbp2 G A 11: 98,551,271 probably benign Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46083029 unclassified probably benign
FR4976:Nolc1 UTSW 19 46081356 small insertion probably benign
FR4976:Nolc1 UTSW 19 46081375 small insertion probably benign
R0106:Nolc1 UTSW 19 46080089 splice site probably benign
R0121:Nolc1 UTSW 19 46081378 unclassified probably benign
R0140:Nolc1 UTSW 19 46081378 unclassified probably benign
R0501:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46084159 missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46080089 splice site probably benign
R1553:Nolc1 UTSW 19 46081375 small insertion probably benign
R1642:Nolc1 UTSW 19 46079022 critical splice donor site probably null
R1698:Nolc1 UTSW 19 46081431 splice site probably null
R2067:Nolc1 UTSW 19 46083607 missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46081359 small insertion probably benign
R2113:Nolc1 UTSW 19 46081361 small insertion probably benign
R2300:Nolc1 UTSW 19 46081359 small insertion probably benign
R2300:Nolc1 UTSW 19 46081368 small insertion probably benign
R2895:Nolc1 UTSW 19 46081352 small insertion probably benign
R2999:Nolc1 UTSW 19 46083155 small deletion probably benign
R3737:Nolc1 UTSW 19 46081353 small insertion probably benign
R3737:Nolc1 UTSW 19 46081370 small insertion probably benign
R3737:Nolc1 UTSW 19 46081377 small insertion probably benign
R3747:Nolc1 UTSW 19 46081356 small insertion probably benign
R3806:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081359 small insertion probably benign
R3807:Nolc1 UTSW 19 46081371 small insertion probably benign
R4035:Nolc1 UTSW 19 46081358 small insertion probably benign
R4619:Nolc1 UTSW 19 46083520 missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46083155 small deletion probably benign
R4999:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46081664 nonsense probably null
R5559:Nolc1 UTSW 19 46083155 small deletion probably benign
R6457:Nolc1 UTSW 19 46083070 unclassified probably benign
R7467:Nolc1 UTSW 19 46082334 missense unknown
R7497:Nolc1 UTSW 19 46082818 missense probably benign 0.23
X0050:Nolc1 UTSW 19 46081352 small deletion probably benign
Y5377:Nolc1 UTSW 19 46081369 small insertion probably benign
Y5379:Nolc1 UTSW 19 46081359 small insertion probably benign
Z1088:Nolc1 UTSW 19 46083098 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCCAAGGTGACTGCTAAAG -3'
(R):5'- CAGATACATGCCTGGCTTGGTC -3'

Sequencing Primer
(F):5'- CAAACAGGCCCCTCAGG -3'
(R):5'- TGGCTTGGTCCCAGCTG -3'
Posted On2016-12-20