Mutagenetix > Incidental Mutations

Incidental Mutation 'R5838:Ifi207'

449693

Institutional Source

Beutler Lab

Gene Symbol

Ifi207

Ensembl Gene

ENSMUSG00000073490

Gene Name

interferon activated gene 207

Synonyms

Pyhin-A, AI607873

MMRRC Submission

044058-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5838 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

173723427-173741747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 173732387 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 173 (Q173L)

Ref Sequence

ENSEMBL: ENSMUSP00000119350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]

Predicted Effect

unknown
Transcript: ENSMUST00000042610
AA Change: Q180L

SMART Domains

Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: Q180L

Domain	Start	End	E-Value	Type
PYRIN	6	84	3.2e-15	SMART
low complexity region	121	133	N/A	INTRINSIC
low complexity region	136	162	N/A	INTRINSIC
low complexity region	207	215	N/A	INTRINSIC
internal_repeat_1	286	472	4.17e-7	PROSPERO
low complexity region	476	496	N/A	INTRINSIC
internal_repeat_1	565	782	4.17e-7	PROSPERO
Pfam:HIN	788	954	4.9e-76	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000127730
AA Change: Q173L

SMART Domains

Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: Q173L

Domain	Start	End	E-Value	Type
PYRIN	6	84	3.2e-15	SMART
low complexity region	121	133	N/A	INTRINSIC
low complexity region	136	155	N/A	INTRINSIC
low complexity region	200	208	N/A	INTRINSIC
internal_repeat_1	279	465	6.41e-7	PROSPERO
low complexity region	469	489	N/A	INTRINSIC
internal_repeat_1	558	775	6.41e-7	PROSPERO
Pfam:HIN	781	948	1.8e-78	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	G	A	11: 105,972,880	V385I	probably benign	Het
Apmap	T	C	2: 150,585,857	Y315C	probably damaging	Het
Arhgef12	G	A	9: 43,005,608	T414I	probably damaging	Het
Cd200r1	C	A	16: 44,766,034	A9D	possibly damaging	Het
Cdkal1	T	C	13: 29,691,686	D183G	probably benign	Het
Clk1	C	A	1: 58,412,660	C432F	probably damaging	Het
Col27a1	G	T	4: 63,225,528	L484F	probably damaging	Het
Col7a1	A	G	9: 108,978,143	E2480G	unknown	Het
D430042O09Rik	A	T	7: 125,867,655	M1361L	possibly damaging	Het
Dnah5	A	G	15: 28,290,195	I1244V	probably benign	Het
Dock3	G	T	9: 106,895,488	P522Q	possibly damaging	Het
Drc1	T	A	5: 30,366,513		probably null	Het
Epas1	C	T	17: 86,823,686	T298I	possibly damaging	Het
Epha1	A	T	6: 42,361,646	I699N	probably damaging	Het
Ephb3	T	C	16: 21,221,687	S558P	probably damaging	Het
Epn1	T	A	7: 5,097,166	L426*	probably null	Het
Fam234b	T	C	6: 135,225,267	V329A	probably benign	Het
Fasn	G	T	11: 120,816,124	R901S	probably damaging	Het
Fbln2	T	C	6: 91,271,848	M1165T	possibly damaging	Het
Fer1l4	T	C	2: 156,051,993	R103G	probably benign	Het
G6pd2	T	A	5: 61,809,225	D114E	probably benign	Het
Galnt10	A	G	11: 57,781,056	K391E	probably damaging	Het
Gpr150	C	A	13: 76,055,926	C300F	probably benign	Het
Hhipl2	A	G	1: 183,423,571	T151A	probably damaging	Het
Hmcn2	C	A	2: 31,457,807	L4822M	probably damaging	Het
Inca1	T	C	11: 70,689,881	E86G	probably damaging	Het
Iqca	A	G	1: 90,144,945	L71P	probably benign	Het
Kank2	G	T	9: 21,795,393	Q110K	probably damaging	Het
Kif13b	A	T	14: 64,737,555	M407L	probably damaging	Het
Kif5a	A	C	10: 127,245,441	I208S	probably damaging	Het
Kmt2c	T	C	5: 25,284,471	K4490R	probably damaging	Het
Ltbp2	C	T	12: 84,789,101	R1352H	probably benign	Het
Macf1	T	C	4: 123,452,154	Q2061R	possibly damaging	Het
Marcks	A	G	10: 37,136,167	S291P	probably benign	Het
Mccc1	A	G	3: 35,985,082	V254A	possibly damaging	Het
Mdn1	C	T	4: 32,754,547	R4683W	probably damaging	Het
Mon2	A	G	10: 123,010,492		probably null	Het
Ndrg4	A	T	8: 95,706,793	H134L	probably damaging	Het
Nek7	C	A	1: 138,534,363		probably null	Het
Nlrc3	C	T	16: 3,953,995	S151N	probably damaging	Het
Nsl1	C	A	1: 191,070,113	A146E	probably benign	Het
Olfr1391	A	C	11: 49,327,933	N174T	probably damaging	Het
Olfr1477	T	A	19: 13,502,558	Y72N	probably damaging	Het
Olfr519	A	T	7: 108,894,085	F107L	probably benign	Het
Olfr655	A	G	7: 104,596,897	Y95H	probably benign	Het
Olfr800	A	T	10: 129,660,038	R77S	probably benign	Het
Pde4d	A	C	13: 109,740,442	S41R	probably damaging	Het
Phlpp1	T	A	1: 106,347,132	L875*	probably null	Het
Pkd1	T	A	17: 24,580,212	S2802T	possibly damaging	Het
Polr3b	A	G	10: 84,674,590	T500A	probably benign	Het
Ppp2r2c	T	C	5: 36,940,187	V239A	probably benign	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Reln	T	A	5: 21,899,113	I3287F	probably damaging	Het
Scube2	T	C	7: 109,808,444	D763G	probably damaging	Het
Setd5	T	C	6: 113,119,435	V534A	probably benign	Het
Slc10a4	T	A	5: 73,012,030	C333S	probably benign	Het
Slc15a1	G	A	14: 121,484,871	A206V	probably damaging	Het
Snx14	A	G	9: 88,391,776	L654P	probably damaging	Het
Sowahc	G	A	10: 59,223,190	A383T	possibly damaging	Het
Taf1b	A	G	12: 24,500,449	D11G	possibly damaging	Het
Tap1	C	T	17: 34,193,305	Q164*	probably null	Het
Tbcel	T	A	9: 42,415,872	R430W	probably damaging	Het
Trappc11	A	T	8: 47,512,559		probably null	Het
Trim15	T	C	17: 36,862,840	I259V	probably damaging	Het
Trpt1	T	C	19: 6,998,300	S141P	probably damaging	Het
Tsc2	T	A	17: 24,613,216	Q732L	probably benign	Het
Tstd3	C	A	4: 21,759,622		probably null	Het
Unc13d	T	C	11: 116,064,625	K914R	possibly damaging	Het
Unk	A	G	11: 116,049,331	E170G	probably damaging	Het
Uqcc2	T	A	17: 27,125,886	K62*	probably null	Het
Vim	A	G	2: 13,580,190	D394G	probably damaging	Het
Wdr47	G	A	3: 108,624,736		probably null	Het

Other mutations in Ifi207

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01776:Ifi207	APN	1	173725044	missense	probably damaging	1.00
IGL01864:Ifi207	APN	1	173736441	missense	possibly damaging	0.72
IGL02293:Ifi207	APN	1	173723748	missense	probably damaging	1.00
IGL02402:Ifi207	APN	1	173727593	missense	probably damaging	1.00
IGL03160:Ifi207	APN	1	173735104	splice site	probably benign
PIT4458001:Ifi207	UTSW	1	173735172	missense	unknown
R0043:Ifi207	UTSW	1	173729112	missense	possibly damaging	0.48
R0212:Ifi207	UTSW	1	173736398	missense	possibly damaging	0.85
R0395:Ifi207	UTSW	1	173729865	missense	possibly damaging	0.85
R0506:Ifi207	UTSW	1	173736312	missense	possibly damaging	0.52
R0843:Ifi207	UTSW	1	173727577	missense	probably damaging	1.00
R1302:Ifi207	UTSW	1	173735295	missense	possibly damaging	0.96
R1373:Ifi207	UTSW	1	173730347	missense	unknown
R1462:Ifi207	UTSW	1	173724947	missense	probably damaging	1.00
R1462:Ifi207	UTSW	1	173724947	missense	probably damaging	1.00
R1471:Ifi207	UTSW	1	173730063	missense	unknown
R1502:Ifi207	UTSW	1	173729306	missense	possibly damaging	0.56
R1533:Ifi207	UTSW	1	173727740	missense	probably benign	0.30
R1831:Ifi207	UTSW	1	173732426	missense	unknown
R1928:Ifi207	UTSW	1	173729645	missense	possibly damaging	0.68
R1982:Ifi207	UTSW	1	173735239	missense	probably benign	0.01
R2132:Ifi207	UTSW	1	173729771	missense	possibly damaging	0.84
R2248:Ifi207	UTSW	1	173736470	splice site	probably benign
R3703:Ifi207	UTSW	1	173727463	nonsense	probably null
R3741:Ifi207	UTSW	1	173727562	missense	probably damaging	1.00
R3846:Ifi207	UTSW	1	173735303	missense	probably benign	0.33
R4747:Ifi207	UTSW	1	173729067	missense	probably benign	0.00
R4772:Ifi207	UTSW	1	173727687	missense	probably damaging	1.00
R4776:Ifi207	UTSW	1	173730056	missense	unknown
R4855:Ifi207	UTSW	1	173729815	missense	probably damaging	0.96
R5170:Ifi207	UTSW	1	173730498	missense	unknown
R5244:Ifi207	UTSW	1	173729937	missense	probably benign	0.04
R5280:Ifi207	UTSW	1	173730304	missense	unknown
R5301:Ifi207	UTSW	1	173729411	missense	possibly damaging	0.83
R5334:Ifi207	UTSW	1	173727531	missense	probably benign	0.21
R5445:Ifi207	UTSW	1	173727797	missense	probably damaging	0.99
R5691:Ifi207	UTSW	1	173732426	missense	unknown
R6060:Ifi207	UTSW	1	173730527	missense	unknown
R6220:Ifi207	UTSW	1	173729546	missense	probably damaging	0.99
R6264:Ifi207	UTSW	1	173727545	missense	probably damaging	1.00
R6307:Ifi207	UTSW	1	173725053	missense	probably damaging	1.00
R6326:Ifi207	UTSW	1	173729966	missense	probably benign	0.01
R6394:Ifi207	UTSW	1	173729015	missense	probably benign	0.43
R6532:Ifi207	UTSW	1	173729645	missense	possibly damaging	0.68
R6660:Ifi207	UTSW	1	173729406	missense	probably benign	0.01
R6893:Ifi207	UTSW	1	173727642	missense	possibly damaging	0.95
R7190:Ifi207	UTSW	1	173730252	missense	unknown
R7192:Ifi207	UTSW	1	173729018	missense	not run
R7194:Ifi207	UTSW	1	173729924	missense	possibly damaging	0.84
R7327:Ifi207	UTSW	1	173729015	missense	probably benign	0.43
R7348:Ifi207	UTSW	1	173729196	small deletion	probably benign
R7404:Ifi207	UTSW	1	173728928	missense	possibly damaging	0.92
R7442:Ifi207	UTSW	1	173727431	missense	probably benign	0.03
R7500:Ifi207	UTSW	1	173729196	small deletion	probably benign
X0003:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0004:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0005:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0009:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0010:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0011:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0012:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0013:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0014:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0017:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0018:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0019:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0020:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0021:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0022:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0023:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0024:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0025:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0026:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0027:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0028:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0033:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0034:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0035:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0036:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0037:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0038:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0039:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0040:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0050:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0052:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0053:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0054:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0057:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0058:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0060:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0061:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0062:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0063:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0064:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0065:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0066:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98
X0067:Ifi207	UTSW	1	173728982	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGAGGCTGTGTTACATGATAAGGTAAC -3'
(R):5'- GACATTCCCAAAGGCTTATGATG -3'

Sequencing Primer
(F):5'- TTCCAAGATTGTGGGGAGCCC -3'
(R):5'- ACTGTGTACAAGGCTCAG -3'

Posted On

2016-12-20