Incidental Mutation 'R5838:Epn1'
ID449721
Institutional Source Beutler Lab
Gene Symbol Epn1
Ensembl Gene ENSMUSG00000035203
Gene Nameepsin 1
SynonymsIbp1
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5838 (G1)
Quality Score200
Status Not validated
Chromosome7
Chromosomal Location5080235-5098178 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5097166 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 426 (L426*)
Ref Sequence ENSEMBL: ENSMUSP00000146638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000208634]
Predicted Effect probably null
Transcript: ENSMUST00000045277
AA Change: L425*
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203
AA Change: L425*

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098845
AA Change: L425*
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203
AA Change: L425*

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155436
Predicted Effect probably null
Transcript: ENSMUST00000208634
AA Change: L426*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epsin protein family. The encoded protein binds clathrin and is involved in the endocytosis of clathrin-coated vesicles. Loss of function of this gene is associated with reduced tumor growth and progression in certain cancer types. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Epn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Epn1 APN 7 5095036 missense probably benign 0.19
IGL03126:Epn1 APN 7 5095685 missense probably benign 0.01
epsilon UTSW 7 5095048 missense probably benign
R1074:Epn1 UTSW 7 5095048 missense probably benign
R1365:Epn1 UTSW 7 5093370 missense probably benign 0.05
R1848:Epn1 UTSW 7 5089998 missense probably damaging 1.00
R2041:Epn1 UTSW 7 5083875 missense probably damaging 0.99
R2237:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2238:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2239:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R4255:Epn1 UTSW 7 5097638 missense probably damaging 1.00
R4324:Epn1 UTSW 7 5097211 missense probably benign 0.07
R4542:Epn1 UTSW 7 5093981 missense possibly damaging 0.63
R4703:Epn1 UTSW 7 5095148 missense probably damaging 0.99
R4740:Epn1 UTSW 7 5090013 missense probably damaging 1.00
R4845:Epn1 UTSW 7 5093909 missense possibly damaging 0.94
R5952:Epn1 UTSW 7 5093912 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095926 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095936 missense probably damaging 1.00
R6296:Epn1 UTSW 7 5090123 missense probably damaging 0.98
R6710:Epn1 UTSW 7 5097304 missense probably damaging 0.99
R6937:Epn1 UTSW 7 5089944 missense probably damaging 1.00
R7196:Epn1 UTSW 7 5093381 missense possibly damaging 0.68
R7420:Epn1 UTSW 7 5097688 missense possibly damaging 0.77
X0065:Epn1 UTSW 7 5095093 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTCTCCTGAGATCTTGAGTCTATC -3'
(R):5'- TCCACAAGGGCTGCATTAGG -3'

Sequencing Primer
(F):5'- CACAGTAAGATCCTCGCGGTTTTTAG -3'
(R):5'- CTGCATTAGGGCCTAGGAATGACTC -3'
Posted On2016-12-20