Incidental Mutation 'R5838:D430042O09Rik'
ID449726
Institutional Source Beutler Lab
Gene Symbol D430042O09Rik
Ensembl Gene ENSMUSG00000032743
Gene NameRIKEN cDNA D430042O09 gene
Synonyms
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5838 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location125707888-125874793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125867655 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1361 (M1361L)
Ref Sequence ENSEMBL: ENSMUSP00000118668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069660
AA Change: M1387L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743
AA Change: M1387L

DomainStartEndE-ValueType
internal_repeat_3 442 586 9.64e-5 PROSPERO
internal_repeat_2 454 607 1.91e-6 PROSPERO
low complexity region 704 718 N/A INTRINSIC
Pfam:DUF4457 909 1099 5.1e-43 PFAM
Pfam:DUF4457 1205 1524 8.4e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124223
AA Change: M1361L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743
AA Change: M1361L

DomainStartEndE-ValueType
internal_repeat_3 416 560 8.9e-5 PROSPERO
internal_repeat_2 428 581 1.74e-6 PROSPERO
low complexity region 678 692 N/A INTRINSIC
Pfam:DUF4457 882 1073 1.4e-39 PFAM
Pfam:DUF4457 1179 1498 2.2e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132204
AA Change: M134L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115955
Gene: ENSMUSG00000032743
AA Change: M134L

DomainStartEndE-ValueType
Pfam:DUF4457 1 143 3.6e-51 PFAM
Pfam:DUF4457 139 219 2.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205462
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Ndrg4 A T 8: 95,706,793 H134L probably damaging Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in D430042O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:D430042O09Rik APN 7 125795450 missense possibly damaging 0.75
IGL00950:D430042O09Rik APN 7 125843221 missense probably benign
IGL01089:D430042O09Rik APN 7 125795313 missense probably damaging 1.00
IGL01099:D430042O09Rik APN 7 125865320 missense probably damaging 1.00
IGL01449:D430042O09Rik APN 7 125870685 missense probably damaging 1.00
IGL01545:D430042O09Rik APN 7 125752971 critical splice acceptor site probably null
IGL01937:D430042O09Rik APN 7 125854605 missense probably benign 0.13
IGL01949:D430042O09Rik APN 7 125761842 nonsense probably null
IGL02096:D430042O09Rik APN 7 125814821 missense probably benign 0.09
IGL02148:D430042O09Rik APN 7 125873476 unclassified probably null
IGL02274:D430042O09Rik APN 7 125770570 critical splice acceptor site probably null
IGL02323:D430042O09Rik APN 7 125842829 missense probably benign 0.04
IGL02574:D430042O09Rik APN 7 125829753 missense possibly damaging 0.48
IGL02639:D430042O09Rik APN 7 125872792 missense probably damaging 1.00
IGL02833:D430042O09Rik APN 7 125850412 nonsense probably null
IGL03003:D430042O09Rik APN 7 125851960 missense probably damaging 1.00
IGL03011:D430042O09Rik APN 7 125852002 missense probably benign 0.01
IGL03332:D430042O09Rik APN 7 125820105 nonsense probably null
IGL03368:D430042O09Rik APN 7 125868858 intron probably benign
E0370:D430042O09Rik UTSW 7 125850302 missense probably benign 0.06
PIT4498001:D430042O09Rik UTSW 7 125813596 missense probably benign
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0472:D430042O09Rik UTSW 7 125872967 missense probably damaging 0.98
R0479:D430042O09Rik UTSW 7 125843346 missense probably benign 0.20
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1223:D430042O09Rik UTSW 7 125760423 missense possibly damaging 0.75
R1299:D430042O09Rik UTSW 7 125852023 missense probably benign
R1331:D430042O09Rik UTSW 7 125866455 missense probably benign 0.00
R1484:D430042O09Rik UTSW 7 125816571 splice site probably benign
R1507:D430042O09Rik UTSW 7 125866352 missense probably damaging 1.00
R1562:D430042O09Rik UTSW 7 125842848 missense probably damaging 1.00
R1992:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R2008:D430042O09Rik UTSW 7 125860566 missense probably damaging 1.00
R2010:D430042O09Rik UTSW 7 125872956 missense possibly damaging 0.93
R2147:D430042O09Rik UTSW 7 125865320 missense probably damaging 1.00
R2508:D430042O09Rik UTSW 7 125795343 missense probably benign
R3015:D430042O09Rik UTSW 7 125866340 missense probably damaging 1.00
R3794:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R3795:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R4043:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4044:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4692:D430042O09Rik UTSW 7 125867669 critical splice donor site probably null
R4772:D430042O09Rik UTSW 7 125865351 missense probably damaging 0.96
R5155:D430042O09Rik UTSW 7 125872184 missense probably damaging 1.00
R5467:D430042O09Rik UTSW 7 125843355 missense possibly damaging 0.65
R5551:D430042O09Rik UTSW 7 125820077 missense probably damaging 1.00
R5560:D430042O09Rik UTSW 7 125854561 missense probably benign 0.00
R5662:D430042O09Rik UTSW 7 125842703 missense probably benign 0.00
R5667:D430042O09Rik UTSW 7 125843455 critical splice donor site probably null
R5958:D430042O09Rik UTSW 7 125813635 missense probably benign 0.01
R5983:D430042O09Rik UTSW 7 125850373 missense probably damaging 1.00
R6084:D430042O09Rik UTSW 7 125814865 missense probably benign
R6241:D430042O09Rik UTSW 7 125872834 missense probably benign 0.00
R6298:D430042O09Rik UTSW 7 125870697 missense probably benign 0.11
R6345:D430042O09Rik UTSW 7 125752987 missense probably damaging 0.97
R6554:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R6715:D430042O09Rik UTSW 7 125761829 nonsense probably null
R6745:D430042O09Rik UTSW 7 125770650 missense probably benign 0.00
R7178:D430042O09Rik UTSW 7 125866327 missense probably benign 0.00
R7210:D430042O09Rik UTSW 7 125872239 missense probably damaging 1.00
R7404:D430042O09Rik UTSW 7 125865262 missense probably damaging 1.00
R7561:D430042O09Rik UTSW 7 125842722 missense probably benign
R7571:D430042O09Rik UTSW 7 125708021 unclassified probably benign
U24488:D430042O09Rik UTSW 7 125770681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCACTTTTAGGTACTCTAAGGC -3'
(R):5'- GTCCCTGCCATATTTCTGGG -3'

Sequencing Primer
(F):5'- ACTCTAAGGCTTACAAGGGTCTG -3'
(R):5'- TGCCATATTTCTGGGTCATCTG -3'
Posted On2016-12-20