Incidental Mutation 'R5838:Ndrg4'
ID449728
Institutional Source Beutler Lab
Gene Symbol Ndrg4
Ensembl Gene ENSMUSG00000036564
Gene NameN-myc downstream regulated gene 4
SynonymsD8Bwg1337e, Ndr1-rs, SMAP-8, Ndr4
MMRRC Submission 044058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5838 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95676980-95715119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95706793 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 134 (H134L)
Ref Sequence ENSEMBL: ENSMUSP00000125703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041318] [ENSMUST00000073139] [ENSMUST00000080666] [ENSMUST00000160964] [ENSMUST00000162578] [ENSMUST00000166358] [ENSMUST00000212160]
Predicted Effect probably damaging
Transcript: ENSMUST00000041318
AA Change: H154L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036226
Gene: ENSMUSG00000036564
AA Change: H154L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ndr 60 342 3.1e-126 PFAM
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073139
AA Change: H102L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000072883
Gene: ENSMUSG00000036564
AA Change: H102L

DomainStartEndE-ValueType
Pfam:Ndr 8 290 2e-126 PFAM
Pfam:Abhydrolase_6 43 278 1.2e-16 PFAM
low complexity region 308 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080666
AA Change: H102L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000079495
Gene: ENSMUSG00000036564
AA Change: H102L

DomainStartEndE-ValueType
Pfam:Ndr 8 290 9.9e-127 PFAM
Pfam:Abhydrolase_6 43 278 1.1e-16 PFAM
low complexity region 295 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159851
Predicted Effect unknown
Transcript: ENSMUST00000160915
AA Change: T45S
Predicted Effect probably damaging
Transcript: ENSMUST00000160964
AA Change: H134L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125703
Gene: ENSMUSG00000036564
AA Change: H134L

DomainStartEndE-ValueType
Pfam:Ndr 40 225 6.8e-85 PFAM
Pfam:Abhydrolase_6 75 223 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162578
Predicted Effect probably benign
Transcript: ENSMUST00000166358
SMART Domains Protein: ENSMUSP00000131203
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212160
AA Change: H102L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spatial learning deficits and increased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,972,880 V385I probably benign Het
Apmap T C 2: 150,585,857 Y315C probably damaging Het
Arhgef12 G A 9: 43,005,608 T414I probably damaging Het
Cd200r1 C A 16: 44,766,034 A9D possibly damaging Het
Cdkal1 T C 13: 29,691,686 D183G probably benign Het
Clk1 C A 1: 58,412,660 C432F probably damaging Het
Col27a1 G T 4: 63,225,528 L484F probably damaging Het
Col7a1 A G 9: 108,978,143 E2480G unknown Het
D430042O09Rik A T 7: 125,867,655 M1361L possibly damaging Het
Dnah5 A G 15: 28,290,195 I1244V probably benign Het
Dock3 G T 9: 106,895,488 P522Q possibly damaging Het
Drc1 T A 5: 30,366,513 probably null Het
Epas1 C T 17: 86,823,686 T298I possibly damaging Het
Epha1 A T 6: 42,361,646 I699N probably damaging Het
Ephb3 T C 16: 21,221,687 S558P probably damaging Het
Epn1 T A 7: 5,097,166 L426* probably null Het
Fam234b T C 6: 135,225,267 V329A probably benign Het
Fasn G T 11: 120,816,124 R901S probably damaging Het
Fbln2 T C 6: 91,271,848 M1165T possibly damaging Het
Fer1l4 T C 2: 156,051,993 R103G probably benign Het
G6pd2 T A 5: 61,809,225 D114E probably benign Het
Galnt10 A G 11: 57,781,056 K391E probably damaging Het
Gpr150 C A 13: 76,055,926 C300F probably benign Het
Hhipl2 A G 1: 183,423,571 T151A probably damaging Het
Hmcn2 C A 2: 31,457,807 L4822M probably damaging Het
Ifi207 T A 1: 173,732,387 Q173L unknown Het
Inca1 T C 11: 70,689,881 E86G probably damaging Het
Iqca A G 1: 90,144,945 L71P probably benign Het
Kank2 G T 9: 21,795,393 Q110K probably damaging Het
Kif13b A T 14: 64,737,555 M407L probably damaging Het
Kif5a A C 10: 127,245,441 I208S probably damaging Het
Kmt2c T C 5: 25,284,471 K4490R probably damaging Het
Ltbp2 C T 12: 84,789,101 R1352H probably benign Het
Macf1 T C 4: 123,452,154 Q2061R possibly damaging Het
Marcks A G 10: 37,136,167 S291P probably benign Het
Mccc1 A G 3: 35,985,082 V254A possibly damaging Het
Mdn1 C T 4: 32,754,547 R4683W probably damaging Het
Mon2 A G 10: 123,010,492 probably null Het
Nek7 C A 1: 138,534,363 probably null Het
Nlrc3 C T 16: 3,953,995 S151N probably damaging Het
Nsl1 C A 1: 191,070,113 A146E probably benign Het
Olfr1391 A C 11: 49,327,933 N174T probably damaging Het
Olfr1477 T A 19: 13,502,558 Y72N probably damaging Het
Olfr519 A T 7: 108,894,085 F107L probably benign Het
Olfr655 A G 7: 104,596,897 Y95H probably benign Het
Olfr800 A T 10: 129,660,038 R77S probably benign Het
Pde4d A C 13: 109,740,442 S41R probably damaging Het
Phlpp1 T A 1: 106,347,132 L875* probably null Het
Pkd1 T A 17: 24,580,212 S2802T possibly damaging Het
Polr3b A G 10: 84,674,590 T500A probably benign Het
Ppp2r2c T C 5: 36,940,187 V239A probably benign Het
Pramef6 A G 4: 143,896,920 V228A probably benign Het
Reln T A 5: 21,899,113 I3287F probably damaging Het
Scube2 T C 7: 109,808,444 D763G probably damaging Het
Setd5 T C 6: 113,119,435 V534A probably benign Het
Slc10a4 T A 5: 73,012,030 C333S probably benign Het
Slc15a1 G A 14: 121,484,871 A206V probably damaging Het
Snx14 A G 9: 88,391,776 L654P probably damaging Het
Sowahc G A 10: 59,223,190 A383T possibly damaging Het
Taf1b A G 12: 24,500,449 D11G possibly damaging Het
Tap1 C T 17: 34,193,305 Q164* probably null Het
Tbcel T A 9: 42,415,872 R430W probably damaging Het
Trappc11 A T 8: 47,512,559 probably null Het
Trim15 T C 17: 36,862,840 I259V probably damaging Het
Trpt1 T C 19: 6,998,300 S141P probably damaging Het
Tsc2 T A 17: 24,613,216 Q732L probably benign Het
Tstd3 C A 4: 21,759,622 probably null Het
Unc13d T C 11: 116,064,625 K914R possibly damaging Het
Unk A G 11: 116,049,331 E170G probably damaging Het
Uqcc2 T A 17: 27,125,886 K62* probably null Het
Vim A G 2: 13,580,190 D394G probably damaging Het
Wdr47 G A 3: 108,624,736 probably null Het
Other mutations in Ndrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Ndrg4 APN 8 95706266 missense probably damaging 1.00
IGL01832:Ndrg4 APN 8 95713319 missense probably damaging 1.00
R0325:Ndrg4 UTSW 8 95710935 missense probably damaging 1.00
R1710:Ndrg4 UTSW 8 95710686 missense probably damaging 1.00
R1716:Ndrg4 UTSW 8 95712328 missense probably benign 0.00
R2393:Ndrg4 UTSW 8 95706211 nonsense probably null
R2897:Ndrg4 UTSW 8 95678386 splice site probably null
R2898:Ndrg4 UTSW 8 95678386 splice site probably null
R6264:Ndrg4 UTSW 8 95709768 missense probably damaging 0.99
R6893:Ndrg4 UTSW 8 95706601 nonsense probably null
R8070:Ndrg4 UTSW 8 95700128 missense possibly damaging 0.69
Z1177:Ndrg4 UTSW 8 95710961 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATCACCAAACACTTTGTGGTG -3'
(R):5'- AAACTTGGCCAGCACGTAGG -3'

Sequencing Primer
(F):5'- GTGTGCCACGTGGATGC -3'
(R):5'- CCAGCACGTAGGCTCCG -3'
Posted On2016-12-20