Mutagenetix > Incidental Mutations

Incidental Mutation 'R5838:Tsc2'

449764

Institutional Source

Beutler Lab

Gene Symbol

Tsc2

Ensembl Gene

ENSMUSG00000002496

Gene Name

tuberous sclerosis 2

Synonyms

tuberin, Nafld

MMRRC Submission

044058-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5838 (G1)

Quality Score

149

Status

Not validated

Chromosome

Chromosomal Location

24595816-24632630 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24613216 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 732 (Q732L)

Ref Sequence

ENSEMBL: ENSMUSP00000154338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000228412]

Predicted Effect

probably benign
Transcript: ENSMUST00000097373
AA Change: Q732L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: Q732L

Domain	Start	End	E-Value	Type
Pfam:DUF3384	54	470	4e-103	PFAM
Pfam:Tuberin	555	903	5.9e-149	PFAM
low complexity region	1023	1054	N/A	INTRINSIC
low complexity region	1271	1278	N/A	INTRINSIC
low complexity region	1310	1328	N/A	INTRINSIC
low complexity region	1330	1344	N/A	INTRINSIC
low complexity region	1378	1398	N/A	INTRINSIC
Pfam:Rap_GAP	1497	1685	1.3e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226242

Predicted Effect

probably benign
Transcript: ENSMUST00000226284
AA Change: Q732L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

probably benign
Transcript: ENSMUST00000226398
AA Change: Q732L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227543

Predicted Effect

probably benign
Transcript: ENSMUST00000227607
AA Change: Q673L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000227745
AA Change: Q732L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227754

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228220

Predicted Effect

probably benign
Transcript: ENSMUST00000228412
AA Change: Q732L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ace	G	A	11: 105,972,880	V385I	probably benign	Het
Apmap	T	C	2: 150,585,857	Y315C	probably damaging	Het
Arhgef12	G	A	9: 43,005,608	T414I	probably damaging	Het
Cd200r1	C	A	16: 44,766,034	A9D	possibly damaging	Het
Cdkal1	T	C	13: 29,691,686	D183G	probably benign	Het
Clk1	C	A	1: 58,412,660	C432F	probably damaging	Het
Col27a1	G	T	4: 63,225,528	L484F	probably damaging	Het
Col7a1	A	G	9: 108,978,143	E2480G	unknown	Het
D430042O09Rik	A	T	7: 125,867,655	M1361L	possibly damaging	Het
Dnah5	A	G	15: 28,290,195	I1244V	probably benign	Het
Dock3	G	T	9: 106,895,488	P522Q	possibly damaging	Het
Drc1	T	A	5: 30,366,513		probably null	Het
Epas1	C	T	17: 86,823,686	T298I	possibly damaging	Het
Epha1	A	T	6: 42,361,646	I699N	probably damaging	Het
Ephb3	T	C	16: 21,221,687	S558P	probably damaging	Het
Epn1	T	A	7: 5,097,166	L426*	probably null	Het
Fam234b	T	C	6: 135,225,267	V329A	probably benign	Het
Fasn	G	T	11: 120,816,124	R901S	probably damaging	Het
Fbln2	T	C	6: 91,271,848	M1165T	possibly damaging	Het
Fer1l4	T	C	2: 156,051,993	R103G	probably benign	Het
G6pd2	T	A	5: 61,809,225	D114E	probably benign	Het
Galnt10	A	G	11: 57,781,056	K391E	probably damaging	Het
Gpr150	C	A	13: 76,055,926	C300F	probably benign	Het
Hhipl2	A	G	1: 183,423,571	T151A	probably damaging	Het
Hmcn2	C	A	2: 31,457,807	L4822M	probably damaging	Het
Ifi207	T	A	1: 173,732,387	Q173L	unknown	Het
Inca1	T	C	11: 70,689,881	E86G	probably damaging	Het
Iqca	A	G	1: 90,144,945	L71P	probably benign	Het
Kank2	G	T	9: 21,795,393	Q110K	probably damaging	Het
Kif13b	A	T	14: 64,737,555	M407L	probably damaging	Het
Kif5a	A	C	10: 127,245,441	I208S	probably damaging	Het
Kmt2c	T	C	5: 25,284,471	K4490R	probably damaging	Het
Ltbp2	C	T	12: 84,789,101	R1352H	probably benign	Het
Macf1	T	C	4: 123,452,154	Q2061R	possibly damaging	Het
Marcks	A	G	10: 37,136,167	S291P	probably benign	Het
Mccc1	A	G	3: 35,985,082	V254A	possibly damaging	Het
Mdn1	C	T	4: 32,754,547	R4683W	probably damaging	Het
Mon2	A	G	10: 123,010,492		probably null	Het
Ndrg4	A	T	8: 95,706,793	H134L	probably damaging	Het
Nek7	C	A	1: 138,534,363		probably null	Het
Nlrc3	C	T	16: 3,953,995	S151N	probably damaging	Het
Nsl1	C	A	1: 191,070,113	A146E	probably benign	Het
Olfr1391	A	C	11: 49,327,933	N174T	probably damaging	Het
Olfr1477	T	A	19: 13,502,558	Y72N	probably damaging	Het
Olfr519	A	T	7: 108,894,085	F107L	probably benign	Het
Olfr655	A	G	7: 104,596,897	Y95H	probably benign	Het
Olfr800	A	T	10: 129,660,038	R77S	probably benign	Het
Pde4d	A	C	13: 109,740,442	S41R	probably damaging	Het
Phlpp1	T	A	1: 106,347,132	L875*	probably null	Het
Pkd1	T	A	17: 24,580,212	S2802T	possibly damaging	Het
Polr3b	A	G	10: 84,674,590	T500A	probably benign	Het
Ppp2r2c	T	C	5: 36,940,187	V239A	probably benign	Het
Pramef6	A	G	4: 143,896,920	V228A	probably benign	Het
Reln	T	A	5: 21,899,113	I3287F	probably damaging	Het
Scube2	T	C	7: 109,808,444	D763G	probably damaging	Het
Setd5	T	C	6: 113,119,435	V534A	probably benign	Het
Slc10a4	T	A	5: 73,012,030	C333S	probably benign	Het
Slc15a1	G	A	14: 121,484,871	A206V	probably damaging	Het
Snx14	A	G	9: 88,391,776	L654P	probably damaging	Het
Sowahc	G	A	10: 59,223,190	A383T	possibly damaging	Het
Taf1b	A	G	12: 24,500,449	D11G	possibly damaging	Het
Tap1	C	T	17: 34,193,305	Q164*	probably null	Het
Tbcel	T	A	9: 42,415,872	R430W	probably damaging	Het
Trappc11	A	T	8: 47,512,559		probably null	Het
Trim15	T	C	17: 36,862,840	I259V	probably damaging	Het
Trpt1	T	C	19: 6,998,300	S141P	probably damaging	Het
Tstd3	C	A	4: 21,759,622		probably null	Het
Unc13d	T	C	11: 116,064,625	K914R	possibly damaging	Het
Unk	A	G	11: 116,049,331	E170G	probably damaging	Het
Uqcc2	T	A	17: 27,125,886	K62*	probably null	Het
Vim	A	G	2: 13,580,190	D394G	probably damaging	Het
Wdr47	G	A	3: 108,624,736		probably null	Het

Other mutations in Tsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Tsc2	APN	17	24608107	missense	probably damaging	1.00
IGL00985:Tsc2	APN	17	24597131	missense	probably damaging	1.00
IGL01386:Tsc2	APN	17	24613285	missense	probably damaging	1.00
IGL01468:Tsc2	APN	17	24621097	missense	possibly damaging	0.90
IGL01530:Tsc2	APN	17	24622662	missense	possibly damaging	0.76
IGL02390:Tsc2	APN	17	24600453	missense	probably damaging	1.00
IGL02398:Tsc2	APN	17	24621729	missense	probably damaging	1.00
IGL02741:Tsc2	APN	17	24629969	missense	probably damaging	1.00
IGL03191:Tsc2	APN	17	24628054	missense	probably damaging	1.00
IGL03372:Tsc2	APN	17	24619470	missense	probably damaging	1.00
IGL03412:Tsc2	APN	17	24597068	missense	probably damaging	0.98
Twitch	UTSW	17	24596742	splice site	probably null
PIT4515001:Tsc2	UTSW	17	24621147	missense	probably benign	0.15
R0025:Tsc2	UTSW	17	24631004	splice site	probably benign
R0025:Tsc2	UTSW	17	24631004	splice site	probably benign
R0138:Tsc2	UTSW	17	24599626	missense	possibly damaging	0.65
R0540:Tsc2	UTSW	17	24621712	missense	probably damaging	1.00
R0570:Tsc2	UTSW	17	24626727	missense	probably damaging	1.00
R0607:Tsc2	UTSW	17	24621712	missense	probably damaging	1.00
R0826:Tsc2	UTSW	17	24596958	missense	probably benign	0.04
R1430:Tsc2	UTSW	17	24599023	critical splice donor site	probably null
R1440:Tsc2	UTSW	17	24614392	missense	probably damaging	1.00
R1466:Tsc2	UTSW	17	24608973	missense	probably damaging	1.00
R1466:Tsc2	UTSW	17	24608973	missense	probably damaging	1.00
R1541:Tsc2	UTSW	17	24631976	missense	probably damaging	1.00
R1717:Tsc2	UTSW	17	24597068	missense	probably damaging	0.98
R1799:Tsc2	UTSW	17	24604408	missense	probably benign
R2030:Tsc2	UTSW	17	24623470	splice site	probably benign
R2147:Tsc2	UTSW	17	24621142	missense	possibly damaging	0.62
R2888:Tsc2	UTSW	17	24631995	critical splice donor site	probably null
R3609:Tsc2	UTSW	17	24622550	missense	possibly damaging	0.74
R3610:Tsc2	UTSW	17	24622550	missense	possibly damaging	0.74
R3811:Tsc2	UTSW	17	24629037	missense	probably benign	0.09
R3895:Tsc2	UTSW	17	24599812	missense	probably damaging	1.00
R3962:Tsc2	UTSW	17	24621166	splice site	probably benign
R3971:Tsc2	UTSW	17	24623588	missense	probably damaging	1.00
R4018:Tsc2	UTSW	17	24625281	missense	probably damaging	0.99
R4184:Tsc2	UTSW	17	24632016	missense	probably benign	0.43
R4435:Tsc2	UTSW	17	24599713	missense	probably benign	0.01
R4437:Tsc2	UTSW	17	24599713	missense	probably benign	0.01
R4474:Tsc2	UTSW	17	24597264	missense	probably damaging	0.98
R4703:Tsc2	UTSW	17	24604909	missense	probably benign	0.13
R4731:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4732:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4733:Tsc2	UTSW	17	24603275	missense	possibly damaging	0.72
R4817:Tsc2	UTSW	17	24596742	splice site	probably null
R4890:Tsc2	UTSW	17	24600035	missense	probably damaging	1.00
R4922:Tsc2	UTSW	17	24600369	missense	probably benign	0.22
R5119:Tsc2	UTSW	17	24603280	missense	probably benign	0.00
R5393:Tsc2	UTSW	17	24600396	missense	possibly damaging	0.89
R5785:Tsc2	UTSW	17	24599887	splice site	probably null
R5857:Tsc2	UTSW	17	24600007	missense	probably damaging	0.99
R5911:Tsc2	UTSW	17	24600387	missense	possibly damaging	0.63
R5988:Tsc2	UTSW	17	24620766	missense	probably damaging	1.00
R6275:Tsc2	UTSW	17	24600420	missense	probably benign	0.00
R6290:Tsc2	UTSW	17	24596910	missense	probably benign	0.04
R6371:Tsc2	UTSW	17	24626714	missense	probably benign	0.00
R6467:Tsc2	UTSW	17	24609127	missense	probably benign	0.04
R6577:Tsc2	UTSW	17	24610499	missense	probably damaging	1.00
R6728:Tsc2	UTSW	17	24621124	missense	probably damaging	1.00
R6918:Tsc2	UTSW	17	24613229	missense	probably damaging	1.00
R6995:Tsc2	UTSW	17	24628054	missense	probably damaging	1.00
R7026:Tsc2	UTSW	17	24626739	missense	probably damaging	0.99
R7136:Tsc2	UTSW	17	24613280	missense	probably benign	0.00
R7236:Tsc2	UTSW	17	24623594	missense	possibly damaging	0.82
R7243:Tsc2	UTSW	17	24599630	missense	probably benign	0.02
R7249:Tsc2	UTSW	17	24607755	missense	probably damaging	1.00
R7450:Tsc2	UTSW	17	24600031	missense	probably damaging	1.00
R7522:Tsc2	UTSW	17	24630965	missense	probably damaging	1.00
R7529:Tsc2	UTSW	17	24597948	missense	probably damaging	0.98
R7637:Tsc2	UTSW	17	24607492	missense	probably benign	0.13
R7781:Tsc2	UTSW	17	24608115	missense	possibly damaging	0.52
R8005:Tsc2	UTSW	17	24599596	missense	probably damaging	0.98
R8262:Tsc2	UTSW	17	24614366	missense	probably benign	0.06
R8268:Tsc2	UTSW	17	24600010	missense	probably benign	0.44
R8400:Tsc2	UTSW	17	24604987	missense	possibly damaging	0.62
Z1177:Tsc2	UTSW	17	24620779	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- CAGTAAAGAACATTCCTCCATGG -3'
(R):5'- GCAGCTTCAAGTATGGATGGAC -3'

Sequencing Primer
(F):5'- TAAAGAACATTCCTCCATGGCCTCTG -3'
(R):5'- ACCCTTGTGTTACCAAGGTCTAGAG -3'

Posted On

2016-12-20