Incidental Mutation 'R0548:Mmp15'
ID44979
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Namematrix metallopeptidase 15
SynonymsMembrane type 2-MMP, MT2-MMP
MMRRC Submission 038740-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0548 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95352268-95375080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95372351 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 602 (V602A)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
Predicted Effect probably damaging
Transcript: ENSMUST00000034243
AA Change: V602A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: V602A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212235
Meta Mutation Damage Score 0.1599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdk5rap2 A T 4: 70,349,142 probably null Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Map1b T C 13: 99,431,683 K1510R unknown Het
Marco T C 1: 120,492,038 T187A probably benign Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Olfr437 T A 6: 43,167,187 I43K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tars2 T C 3: 95,742,659 D470G probably damaging Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Wdr20rt T A 12: 65,227,315 D344E probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1341:Mmp15 UTSW 8 95372303 missense probably benign 0.03
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5233:Mmp15 UTSW 8 95371068 missense probably benign 0.08
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R7788:Mmp15 UTSW 8 95368148 missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGAACGCCTACGGATGGAAC -3'
(R):5'- AGATCTCAAAGCATCTCCTGGCCC -3'

Sequencing Primer
(F):5'- TACGGATGGAACCCGGC -3'
(R):5'- GGGTGCTACCTGATCACAC -3'
Posted On2013-06-11