Incidental Mutation 'R0548:Mmp15'
ID 44979
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Name matrix metallopeptidase 15
Synonyms MT2-MMP, Membrane type 2-MMP
MMRRC Submission 038740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0548 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 96078924-96100921 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96098979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 602 (V602A)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
AlphaFold O54732
Predicted Effect probably damaging
Transcript: ENSMUST00000034243
AA Change: V602A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: V602A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212235
Meta Mutation Damage Score 0.1599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 41,279,504 (GRCm39) C632G probably damaging Het
Adamtsl3 T C 7: 82,178,191 (GRCm39) probably null Het
Agfg1 A G 1: 82,864,152 (GRCm39) T447A probably damaging Het
Ankrd37 C T 8: 46,451,433 (GRCm39) probably null Het
Apob A T 12: 8,056,282 (GRCm39) D1555V probably damaging Het
Asxl3 T A 18: 22,654,849 (GRCm39) probably benign Het
Brca2 C A 5: 150,468,400 (GRCm39) D2242E probably damaging Het
Car5b G A X: 162,762,297 (GRCm39) R282C probably damaging Het
Cdk5rap2 A T 4: 70,267,379 (GRCm39) probably null Het
Cox10 A T 11: 63,867,178 (GRCm39) Y273N probably damaging Het
Dcbld2 A T 16: 58,275,508 (GRCm39) D408V probably damaging Het
Enam A T 5: 88,650,964 (GRCm39) E824D probably damaging Het
Epm2aip1 T C 9: 111,102,409 (GRCm39) Y461H probably damaging Het
Fam72a T A 1: 131,461,599 (GRCm39) S95T probably damaging Het
Fiz1 A T 7: 5,012,167 (GRCm39) V117D possibly damaging Het
Gm10355 C T 3: 101,214,376 (GRCm39) noncoding transcript Het
Gm11595 A T 11: 99,662,967 (GRCm39) C238S unknown Het
Gm7589 T G 9: 59,053,439 (GRCm39) noncoding transcript Het
H6pd A T 4: 150,066,073 (GRCm39) V771E probably damaging Het
Htt T C 5: 35,028,090 (GRCm39) L1782P probably damaging Het
Il33 T C 19: 29,932,047 (GRCm39) S147P probably benign Het
Lct T C 1: 128,212,932 (GRCm39) Y1907C probably damaging Het
Lrp2 G A 2: 69,367,982 (GRCm39) probably benign Het
Maco1 T C 4: 134,533,971 (GRCm39) D550G probably damaging Het
Map1b T C 13: 99,568,191 (GRCm39) K1510R unknown Het
Marco T C 1: 120,419,767 (GRCm39) T187A probably benign Het
Mki67 A T 7: 135,298,637 (GRCm39) N2132K possibly damaging Het
Mki67 T A 7: 135,296,985 (GRCm39) K2683M probably damaging Het
Mphosph10 T A 7: 64,028,548 (GRCm39) M536L probably benign Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
N4bp2 G T 5: 65,965,496 (GRCm39) V1182L probably benign Het
Nlrc5 C A 8: 95,248,411 (GRCm39) F1715L probably null Het
Nsd2 T A 5: 34,050,882 (GRCm39) V1253E probably damaging Het
Numa1 T C 7: 101,644,731 (GRCm39) S236P possibly damaging Het
Or2a52 T A 6: 43,144,121 (GRCm39) I43K probably benign Het
Or4c120 C A 2: 89,000,992 (GRCm39) C188F probably damaging Het
Or8g18 A T 9: 39,149,667 (GRCm39) S18T probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,475,760 (GRCm39) probably benign Het
Pi4ka A T 16: 17,125,582 (GRCm39) N4K possibly damaging Het
Plxna4 A T 6: 32,134,950 (GRCm39) I1751N probably damaging Het
Postn C A 3: 54,274,997 (GRCm39) S122* probably null Het
Ppp4r4 A T 12: 103,579,074 (GRCm39) R762* probably null Het
Rrm1 G T 7: 102,116,274 (GRCm39) probably null Het
Rrp15 A G 1: 186,468,431 (GRCm39) V195A probably benign Het
Rtl1 T A 12: 109,558,089 (GRCm39) D1250V probably damaging Het
Rxrg T C 1: 167,458,788 (GRCm39) probably benign Het
Scn10a T C 9: 119,494,994 (GRCm39) K416E probably benign Het
Serping1 T C 2: 84,600,425 (GRCm39) probably benign Het
Slc12a6 T C 2: 112,166,269 (GRCm39) probably null Het
Smo A T 6: 29,759,585 (GRCm39) Q639L possibly damaging Het
Synrg T C 11: 83,873,014 (GRCm39) probably benign Het
Tars2 T C 3: 95,649,971 (GRCm39) D470G probably damaging Het
Tln1 T C 4: 43,542,709 (GRCm39) N1399S possibly damaging Het
Tmem131 A G 1: 36,877,119 (GRCm39) V240A probably damaging Het
Tmem232 G A 17: 65,689,615 (GRCm39) T500I probably benign Het
Toporsl G A 4: 52,612,140 (GRCm39) V678M possibly damaging Het
Vmn1r7 A T 6: 57,002,066 (GRCm39) F65I probably damaging Het
Wdfy4 C T 14: 32,764,578 (GRCm39) M2257I probably benign Het
Wdr20rt T A 12: 65,274,089 (GRCm39) D344E probably benign Het
Xirp2 C T 2: 67,344,758 (GRCm39) A2333V probably benign Het
Zfyve16 T C 13: 92,631,452 (GRCm39) K1381R probably benign Het
Zscan18 G T 7: 12,508,103 (GRCm39) P466T probably damaging Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 96,092,959 (GRCm39) missense probably benign 0.31
IGL03001:Mmp15 APN 8 96,094,845 (GRCm39) missense probably damaging 0.97
R0147:Mmp15 UTSW 8 96,098,945 (GRCm39) missense probably benign 0.18
R0148:Mmp15 UTSW 8 96,098,945 (GRCm39) missense probably benign 0.18
R0437:Mmp15 UTSW 8 96,097,400 (GRCm39) missense probably benign 0.04
R0465:Mmp15 UTSW 8 96,094,626 (GRCm39) missense probably damaging 1.00
R0574:Mmp15 UTSW 8 96,092,029 (GRCm39) missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 96,098,762 (GRCm39) missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 96,094,856 (GRCm39) missense probably benign 0.01
R1341:Mmp15 UTSW 8 96,098,931 (GRCm39) missense probably benign 0.03
R1428:Mmp15 UTSW 8 96,096,190 (GRCm39) missense probably benign 0.34
R1840:Mmp15 UTSW 8 96,092,048 (GRCm39) missense probably damaging 1.00
R2061:Mmp15 UTSW 8 96,097,407 (GRCm39) missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 96,096,801 (GRCm39) missense probably benign 0.38
R4760:Mmp15 UTSW 8 96,094,824 (GRCm39) missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 96,098,958 (GRCm39) missense probably benign 0.00
R5233:Mmp15 UTSW 8 96,097,696 (GRCm39) missense probably benign 0.08
R5394:Mmp15 UTSW 8 96,093,032 (GRCm39) missense probably damaging 0.96
R5502:Mmp15 UTSW 8 96,094,812 (GRCm39) missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 96,094,729 (GRCm39) missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 96,098,804 (GRCm39) missense probably benign 0.00
R6341:Mmp15 UTSW 8 96,092,091 (GRCm39) critical splice donor site probably null
R6720:Mmp15 UTSW 8 96,091,942 (GRCm39) missense probably benign 0.22
R7788:Mmp15 UTSW 8 96,094,776 (GRCm39) missense probably damaging 1.00
R8033:Mmp15 UTSW 8 96,094,590 (GRCm39) missense probably benign 0.01
R8679:Mmp15 UTSW 8 96,092,982 (GRCm39) missense possibly damaging 0.83
R8791:Mmp15 UTSW 8 96,096,288 (GRCm39) nonsense probably null
R9028:Mmp15 UTSW 8 96,096,316 (GRCm39) missense probably benign 0.01
R9227:Mmp15 UTSW 8 96,092,959 (GRCm39) missense probably benign 0.06
R9230:Mmp15 UTSW 8 96,092,959 (GRCm39) missense probably benign 0.06
R9350:Mmp15 UTSW 8 96,093,002 (GRCm39) missense probably damaging 0.97
R9632:Mmp15 UTSW 8 96,098,731 (GRCm39) critical splice acceptor site probably null
R9695:Mmp15 UTSW 8 96,097,414 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AACGAACGCCTACGGATGGAAC -3'
(R):5'- AGATCTCAAAGCATCTCCTGGCCC -3'

Sequencing Primer
(F):5'- TACGGATGGAACCCGGC -3'
(R):5'- GGGTGCTACCTGATCACAC -3'
Posted On 2013-06-11