Incidental Mutation 'R5839:Tcaf3'
ID 449797
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 044059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5839 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42593849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 323 (E323G)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect possibly damaging
Transcript: ENSMUST00000069023
AA Change: E323G

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: E323G

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (62/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,552,026 K218E probably damaging Het
Adam22 T A 5: 8,136,861 Y420F probably damaging Het
Adcy8 A G 15: 64,716,182 Y919H probably damaging Het
Ampd1 A T 3: 103,085,428 N162I possibly damaging Het
Arhgef15 G A 11: 68,954,156 A205V probably benign Het
Ash1l A G 3: 88,983,351 K846E probably damaging Het
Azi2 C T 9: 118,059,119 T250I probably damaging Het
Btbd16 G A 7: 130,815,808 probably null Het
Ceacam16 T A 7: 19,856,083 K52* probably null Het
Cfap74 T C 4: 155,422,750 probably null Het
Cgn A C 3: 94,774,393 L464R probably damaging Het
Chpt1 T A 10: 88,503,763 H32L probably damaging Het
Clk1 G A 1: 58,421,915 T7I probably benign Het
Col6a5 C T 9: 105,945,393 probably null Het
Cpne4 C A 9: 104,925,828 R224S probably damaging Het
Cysltr2 T C 14: 73,030,183 Y29C probably damaging Het
Ddx5 A G 11: 106,782,206 S498P probably damaging Het
Dgkg A G 16: 22,566,494 Y382H possibly damaging Het
Efemp1 A G 11: 28,921,418 E339G possibly damaging Het
Focad T A 4: 88,196,846 probably benign Het
Gabbr1 G A 17: 37,067,868 G650D probably damaging Het
Galnt9 A G 5: 110,577,520 S108G probably benign Het
Igkv8-28 T A 6: 70,144,161 M1L probably benign Het
Kcnq2 T C 2: 181,109,751 Y284C probably damaging Het
Macf1 A G 4: 123,381,324 F6299S probably damaging Het
Magi3 G A 3: 104,219,731 T79M probably damaging Het
Mdh2 T A 5: 135,783,292 probably null Het
Mgam A C 6: 40,740,064 N108T possibly damaging Het
N4bp3 A T 11: 51,646,082 F55I probably benign Het
Nasp C T 4: 116,602,091 probably null Het
Ncapg T A 5: 45,672,278 H107Q probably damaging Het
Ofcc1 T C 13: 40,280,545 K28R probably damaging Het
Opn1sw C T 6: 29,379,830 C135Y probably damaging Het
Pigo T C 4: 43,022,104 M346V probably damaging Het
Pkn2 A T 3: 142,821,529 D386E probably benign Het
Psd2 G T 18: 36,007,524 V617L probably damaging Het
Rab39 C T 9: 53,706,087 R10H probably damaging Het
Slc6a6 T A 6: 91,723,317 C9S probably damaging Het
Slc8a2 A T 7: 16,134,487 I215F probably damaging Het
Slitrk5 T C 14: 111,679,598 V218A probably benign Het
Smchd1 A T 17: 71,394,862 V1045E probably damaging Het
Smoc1 T C 12: 81,167,585 I247T probably damaging Het
Snapc4 G C 2: 26,365,534 Q993E probably benign Het
Spata5 A G 3: 37,464,654 D779G probably damaging Het
Spidr A T 16: 16,037,502 I383N probably damaging Het
Stab2 A G 10: 86,872,691 V219A probably damaging Het
Tas2r103 T C 6: 133,036,816 T96A probably benign Het
Tecta C T 9: 42,331,023 D2085N probably benign Het
Tecta T C 9: 42,372,976 T938A possibly damaging Het
Tekt2 T A 4: 126,322,836 E328V probably damaging Het
Tgfb1i1 A G 7: 128,253,365 *462W probably null Het
Tnip2 T C 5: 34,496,632 probably benign Het
Tpd52l2 G A 2: 181,499,898 V25I probably benign Het
Traj15 T A 14: 54,204,469 probably benign Het
Trpm8 A T 1: 88,325,506 I106F possibly damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Ttn T C 2: 76,909,428 H3589R probably benign Het
Vmn1r28 T A 6: 58,265,295 I41N possibly damaging Het
Wasf1 T A 10: 40,936,319 V368E unknown Het
Zeb1 A G 18: 5,767,507 M673V probably benign Het
Zfp799 T C 17: 32,822,112 D31G probably null Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42596782 missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42596972 nonsense probably null
R9469:Tcaf3 UTSW 6 42596894 missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGCTAGTGATACCAAGGC -3'
(R):5'- AATTGCTTTCTTGCAGCTGC -3'

Sequencing Primer
(F):5'- CCAAAGCGCTTAAGGACGATGTTATC -3'
(R):5'- CGCTATGGCCGTGGTCG -3'
Posted On 2016-12-20