Incidental Mutation 'R5839:Tas2r103'
ID449800
Institutional Source Beutler Lab
Gene Symbol Tas2r103
Ensembl Gene ENSMUSG00000030196
Gene Nametaste receptor, type 2, member 103
Synonymsmt2r63, T2R3, Tas2r10, EG667992, mGR03, TRB2, Tas2r3
MMRRC Submission 044059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5839 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location133036163-133037101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133036816 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 96 (T96A)
Ref Sequence ENSEMBL: ENSMUSP00000032317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032317]
Predicted Effect probably benign
Transcript: ENSMUST00000032317
AA Change: T96A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032317
Gene: ENSMUSG00000030196
AA Change: T96A

DomainStartEndE-ValueType
Pfam:TAS2R 5 301 1.5e-79 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (62/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,552,026 K218E probably damaging Het
Adam22 T A 5: 8,136,861 Y420F probably damaging Het
Adcy8 A G 15: 64,716,182 Y919H probably damaging Het
Ampd1 A T 3: 103,085,428 N162I possibly damaging Het
Arhgef15 G A 11: 68,954,156 A205V probably benign Het
Ash1l A G 3: 88,983,351 K846E probably damaging Het
Azi2 C T 9: 118,059,119 T250I probably damaging Het
Btbd16 G A 7: 130,815,808 probably null Het
Ceacam16 T A 7: 19,856,083 K52* probably null Het
Cfap74 T C 4: 155,422,750 probably null Het
Cgn A C 3: 94,774,393 L464R probably damaging Het
Chpt1 T A 10: 88,503,763 H32L probably damaging Het
Clk1 G A 1: 58,421,915 T7I probably benign Het
Col6a5 C T 9: 105,945,393 probably null Het
Cpne4 C A 9: 104,925,828 R224S probably damaging Het
Cysltr2 T C 14: 73,030,183 Y29C probably damaging Het
Ddx5 A G 11: 106,782,206 S498P probably damaging Het
Dgkg A G 16: 22,566,494 Y382H possibly damaging Het
Efemp1 A G 11: 28,921,418 E339G possibly damaging Het
Focad T A 4: 88,196,846 probably benign Het
Gabbr1 G A 17: 37,067,868 G650D probably damaging Het
Galnt9 A G 5: 110,577,520 S108G probably benign Het
Igkv8-28 T A 6: 70,144,161 M1L probably benign Het
Kcnq2 T C 2: 181,109,751 Y284C probably damaging Het
Macf1 A G 4: 123,381,324 F6299S probably damaging Het
Magi3 G A 3: 104,219,731 T79M probably damaging Het
Mdh2 T A 5: 135,783,292 probably null Het
Mgam A C 6: 40,740,064 N108T possibly damaging Het
N4bp3 A T 11: 51,646,082 F55I probably benign Het
Nasp C T 4: 116,602,091 probably null Het
Ncapg T A 5: 45,672,278 H107Q probably damaging Het
Ofcc1 T C 13: 40,280,545 K28R probably damaging Het
Opn1sw C T 6: 29,379,830 C135Y probably damaging Het
Pigo T C 4: 43,022,104 M346V probably damaging Het
Pkn2 A T 3: 142,821,529 D386E probably benign Het
Psd2 G T 18: 36,007,524 V617L probably damaging Het
Rab39 C T 9: 53,706,087 R10H probably damaging Het
Slc6a6 T A 6: 91,723,317 C9S probably damaging Het
Slc8a2 A T 7: 16,134,487 I215F probably damaging Het
Slitrk5 T C 14: 111,679,598 V218A probably benign Het
Smchd1 A T 17: 71,394,862 V1045E probably damaging Het
Smoc1 T C 12: 81,167,585 I247T probably damaging Het
Snapc4 G C 2: 26,365,534 Q993E probably benign Het
Spata5 A G 3: 37,464,654 D779G probably damaging Het
Spidr A T 16: 16,037,502 I383N probably damaging Het
Stab2 A G 10: 86,872,691 V219A probably damaging Het
Tcaf3 T C 6: 42,593,849 E323G possibly damaging Het
Tecta C T 9: 42,331,023 D2085N probably benign Het
Tecta T C 9: 42,372,976 T938A possibly damaging Het
Tekt2 T A 4: 126,322,836 E328V probably damaging Het
Tgfb1i1 A G 7: 128,253,365 *462W probably null Het
Tnip2 T C 5: 34,496,632 probably benign Het
Tpd52l2 G A 2: 181,499,898 V25I probably benign Het
Traj15 T A 14: 54,204,469 probably benign Het
Trpm8 A T 1: 88,325,506 I106F possibly damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Ttn T C 2: 76,909,428 H3589R probably benign Het
Vmn1r28 T A 6: 58,265,295 I41N possibly damaging Het
Wasf1 T A 10: 40,936,319 V368E unknown Het
Zeb1 A G 18: 5,767,507 M673V probably benign Het
Zfp799 T C 17: 32,822,112 D31G probably null Het
Other mutations in Tas2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Tas2r103 APN 6 133037056 missense possibly damaging 0.86
IGL02332:Tas2r103 APN 6 133036512 missense probably benign 0.21
IGL03122:Tas2r103 APN 6 133036909 missense probably damaging 1.00
IGL03167:Tas2r103 APN 6 133036660 missense probably damaging 0.98
R0380:Tas2r103 UTSW 6 133036203 missense probably damaging 1.00
R0671:Tas2r103 UTSW 6 133036350 missense probably benign 0.01
R1700:Tas2r103 UTSW 6 133036811 missense probably damaging 1.00
R2098:Tas2r103 UTSW 6 133036597 missense probably benign
R3977:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R3979:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R3980:Tas2r103 UTSW 6 133036317 missense probably benign 0.16
R4924:Tas2r103 UTSW 6 133036198 missense probably benign 0.02
R5779:Tas2r103 UTSW 6 133036945 missense probably benign 0.02
R6265:Tas2r103 UTSW 6 133036531 missense probably damaging 1.00
R7768:Tas2r103 UTSW 6 133036849 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTACAGTTCTGGAGTGTGTTTAC -3'
(R):5'- GCTCTCGTGAACATCATAGACTG -3'

Sequencing Primer
(F):5'- ACTTGAAGTCTGTCAGTGAATTTG -3'
(R):5'- TGAACATCATAGACTGGGTTAAAAG -3'
Posted On2016-12-20