Incidental Mutation 'R5839:Smchd1'
ID449829
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene NameSMC hinge domain containing 1
Synonyms4931400A14Rik, MommeD1
MMRRC Submission 044059-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R5839 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71344489-71475343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71394862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1045 (V1045E)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
Predicted Effect probably damaging
Transcript: ENSMUST00000127430
AA Change: V1045E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: V1045E

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195774
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,552,026 K218E probably damaging Het
Adam22 T A 5: 8,136,861 Y420F probably damaging Het
Adcy8 A G 15: 64,716,182 Y919H probably damaging Het
Ampd1 A T 3: 103,085,428 N162I possibly damaging Het
Arhgef15 G A 11: 68,954,156 A205V probably benign Het
Ash1l A G 3: 88,983,351 K846E probably damaging Het
Azi2 C T 9: 118,059,119 T250I probably damaging Het
Btbd16 G A 7: 130,815,808 probably null Het
Ceacam16 T A 7: 19,856,083 K52* probably null Het
Cfap74 T C 4: 155,422,750 probably null Het
Cgn A C 3: 94,774,393 L464R probably damaging Het
Chpt1 T A 10: 88,503,763 H32L probably damaging Het
Clk1 G A 1: 58,421,915 T7I probably benign Het
Col6a5 C T 9: 105,945,393 probably null Het
Cpne4 C A 9: 104,925,828 R224S probably damaging Het
Cysltr2 T C 14: 73,030,183 Y29C probably damaging Het
Ddx5 A G 11: 106,782,206 S498P probably damaging Het
Dgkg A G 16: 22,566,494 Y382H possibly damaging Het
Efemp1 A G 11: 28,921,418 E339G possibly damaging Het
Focad T A 4: 88,196,846 probably benign Het
Gabbr1 G A 17: 37,067,868 G650D probably damaging Het
Galnt9 A G 5: 110,577,520 S108G probably benign Het
Igkv8-28 T A 6: 70,144,161 M1L probably benign Het
Kcnq2 T C 2: 181,109,751 Y284C probably damaging Het
Macf1 A G 4: 123,381,324 F6299S probably damaging Het
Magi3 G A 3: 104,219,731 T79M probably damaging Het
Mdh2 T A 5: 135,783,292 probably null Het
Mgam A C 6: 40,740,064 N108T possibly damaging Het
N4bp3 A T 11: 51,646,082 F55I probably benign Het
Nasp C T 4: 116,602,091 probably null Het
Ncapg T A 5: 45,672,278 H107Q probably damaging Het
Ofcc1 T C 13: 40,280,545 K28R probably damaging Het
Opn1sw C T 6: 29,379,830 C135Y probably damaging Het
Pigo T C 4: 43,022,104 M346V probably damaging Het
Pkn2 A T 3: 142,821,529 D386E probably benign Het
Psd2 G T 18: 36,007,524 V617L probably damaging Het
Rab39 C T 9: 53,706,087 R10H probably damaging Het
Slc6a6 T A 6: 91,723,317 C9S probably damaging Het
Slc8a2 A T 7: 16,134,487 I215F probably damaging Het
Slitrk5 T C 14: 111,679,598 V218A probably benign Het
Smoc1 T C 12: 81,167,585 I247T probably damaging Het
Snapc4 G C 2: 26,365,534 Q993E probably benign Het
Spata5 A G 3: 37,464,654 D779G probably damaging Het
Spidr A T 16: 16,037,502 I383N probably damaging Het
Stab2 A G 10: 86,872,691 V219A probably damaging Het
Tas2r103 T C 6: 133,036,816 T96A probably benign Het
Tcaf3 T C 6: 42,593,849 E323G possibly damaging Het
Tecta T C 9: 42,372,976 T938A possibly damaging Het
Tecta C T 9: 42,331,023 D2085N probably benign Het
Tekt2 T A 4: 126,322,836 E328V probably damaging Het
Tgfb1i1 A G 7: 128,253,365 *462W probably null Het
Tnip2 T C 5: 34,496,632 probably benign Het
Tpd52l2 G A 2: 181,499,898 V25I probably benign Het
Traj15 T A 14: 54,204,469 probably benign Het
Trpm8 A T 1: 88,325,506 I106F possibly damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Ttn T C 2: 76,909,428 H3589R probably benign Het
Vmn1r28 T A 6: 58,265,295 I41N possibly damaging Het
Wasf1 T A 10: 40,936,319 V368E unknown Het
Zeb1 A G 18: 5,767,507 M673V probably benign Het
Zfp799 T C 17: 32,822,112 D31G probably null Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACGCTGCCTCCTTG -3'
(R):5'- AACTGTGGTAAGATGATCTTCCC -3'

Sequencing Primer
(F):5'- GAACACACAAGCTCATTTCTCATTGG -3'
(R):5'- CTGTGGTAAGATGATCTTCCCTAATG -3'
Posted On2016-12-20