Incidental Mutation 'R5820:Chfr'
ID 449850
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
MMRRC Submission 043400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R5820 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110162739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 475 (D475E)
Ref Sequence ENSEMBL: ENSMUSP00000143480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect possibly damaging
Transcript: ENSMUST00000014812
AA Change: D546E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: D546E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112519
AA Change: D547E

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: D547E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197968
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect possibly damaging
Transcript: ENSMUST00000198633
AA Change: D475E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: D475E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,039,526 V875A probably benign Het
Abcc4 A G 14: 118,604,195 Y596H probably benign Het
Adgrg3 A T 8: 95,039,593 M351L possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef38 A T 3: 133,160,799 D192E probably benign Het
Arhgef40 T C 14: 51,987,496 F33L possibly damaging Het
Arid1b A G 17: 4,996,254 Y439C possibly damaging Het
Bop1 G A 15: 76,454,841 P386S probably damaging Het
Cacna1s A G 1: 136,079,604 H453R probably damaging Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Clcn7 A C 17: 25,149,052 K208T probably damaging Het
Cmya5 G T 13: 93,092,780 N1933K probably benign Het
CN725425 A G 15: 91,260,697 T588A possibly damaging Het
Cwh43 G A 5: 73,428,632 W358* probably null Het
Cyfip2 A T 11: 46,200,704 W1130R probably damaging Het
Ddx60 A T 8: 61,956,121 D397V possibly damaging Het
Disp1 T C 1: 183,135,587 S92G probably benign Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Dzank1 C T 2: 144,513,488 V96M probably damaging Het
Ecscr C A 18: 35,717,267 V52F possibly damaging Het
Epha7 A T 4: 28,949,365 N712I probably damaging Het
Eva1a C T 6: 82,071,173 P11S probably benign Het
Fam187b T C 7: 30,977,152 C29R probably damaging Het
Fau T C 19: 6,059,422 V117A probably benign Het
Fbxw11 A G 11: 32,735,374 D369G probably damaging Het
Fkbp15 A G 4: 62,345,546 F95L probably benign Het
Fkbp6 A T 5: 135,339,920 probably null Het
Fmo9 T C 1: 166,664,601 K367E possibly damaging Het
Gad2 T C 2: 22,690,249 V554A probably benign Het
Gm18025 T C 12: 34,290,632 D154G probably benign Het
Gm4353 A G 7: 116,084,458 F34S possibly damaging Het
Gucy2e A G 11: 69,232,696 I459T probably benign Het
Hpx A G 7: 105,591,788 I426T possibly damaging Het
Hspa9 T C 18: 34,943,174 T362A possibly damaging Het
Insr G A 8: 3,155,976 P1271L probably damaging Het
Jarid2 G A 13: 44,902,301 V328I possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif18b A G 11: 102,913,048 S429P probably benign Het
Lats1 A T 10: 7,705,908 H819L probably damaging Het
Lmnb1 T A 18: 56,740,786 D421E possibly damaging Het
Lrp4 T C 2: 91,492,615 I1148T probably damaging Het
Map1b T A 13: 99,432,824 M1130L unknown Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Myh6 T C 14: 54,958,680 Y554C probably damaging Het
Myl4 T C 11: 104,583,980 F52L probably damaging Het
Nol12 C T 15: 78,940,480 T169I probably benign Het
Nrde2 C T 12: 100,132,287 R707H probably benign Het
Oasl1 G A 5: 114,936,978 V366M possibly damaging Het
Olfr911-ps1 T C 9: 38,524,599 I289T possibly damaging Het
Otogl G A 10: 107,777,117 silent Het
Polrmt C T 10: 79,738,323 probably null Het
Ppil4 A G 10: 7,810,410 D344G probably null Het
Ppp2r3d C T 9: 124,422,765 A69T possibly damaging Het
Prmt3 C T 7: 49,848,806 P487S probably damaging Het
Ptprm A T 17: 66,689,465 L1209H probably damaging Het
Rnf115 G A 3: 96,727,848 probably benign Het
Sec63 A G 10: 42,796,245 D185G possibly damaging Het
Sema4b T C 7: 80,224,958 S699P probably damaging Het
Serpinb3d T G 1: 107,078,359 E333A probably damaging Het
Sh3rf2 T C 18: 42,141,047 L426P possibly damaging Het
Slco6d1 A G 1: 98,499,778 I611M probably damaging Het
Stk31 T A 6: 49,417,285 Y194N probably damaging Het
Tlr9 G A 9: 106,222,707 probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn1r188 G A 13: 22,088,086 G70D possibly damaging Het
Zfp318 A G 17: 46,412,773 M1901V probably benign Het
Zfp407 A T 18: 84,560,524 D821E probably benign Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
R9419:Chfr UTSW 5 110169190 missense probably damaging 1.00
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATATTGATGCAGGGGCTGAAAC -3'
(R):5'- TTGGTCAGAAAATACAGTGTGTGG -3'

Sequencing Primer
(F):5'- TGCATGGCAGGCATTTTACAGAAC -3'
(R):5'- GTTTTGACAGTATACATTTGCAGGC -3'
Posted On 2016-12-20