Mutagenetix > Incidental Mutation

Incidental Mutation 'R5820:Lats1'

449872

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

043400-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R5820 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 7705908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 819 (H819L)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: H819L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: H819L

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: H819L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: H819L

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: H819L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,039,526	V875A	probably benign	Het
Abcc4	A	G	14: 118,604,195	Y596H	probably benign	Het
Adgrg3	A	T	8: 95,039,593	M351L	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef38	A	T	3: 133,160,799	D192E	probably benign	Het
Arhgef40	T	C	14: 51,987,496	F33L	possibly damaging	Het
Arid1b	A	G	17: 4,996,254	Y439C	possibly damaging	Het
Bop1	G	A	15: 76,454,841	P386S	probably damaging	Het
Cacna1s	A	G	1: 136,079,604	H453R	probably damaging	Het
Canx	A	G	11: 50,308,383	V153A	probably damaging	Het
Chfr	T	A	5: 110,162,739	D475E	possibly damaging	Het
Clcn7	A	C	17: 25,149,052	K208T	probably damaging	Het
Cmya5	G	T	13: 93,092,780	N1933K	probably benign	Het
CN725425	A	G	15: 91,260,697	T588A	possibly damaging	Het
Cwh43	G	A	5: 73,428,632	W358*	probably null	Het
Cyfip2	A	T	11: 46,200,704	W1130R	probably damaging	Het
Ddx60	A	T	8: 61,956,121	D397V	possibly damaging	Het
Disp1	T	C	1: 183,135,587	S92G	probably benign	Het
Dusp6	A	G	10: 99,264,002	D104G	possibly damaging	Het
Dzank1	C	T	2: 144,513,488	V96M	probably damaging	Het
Ecscr	C	A	18: 35,717,267	V52F	possibly damaging	Het
Epha7	A	T	4: 28,949,365	N712I	probably damaging	Het
Eva1a	C	T	6: 82,071,173	P11S	probably benign	Het
Fam187b	T	C	7: 30,977,152	C29R	probably damaging	Het
Fau	T	C	19: 6,059,422	V117A	probably benign	Het
Fbxw11	A	G	11: 32,735,374	D369G	probably damaging	Het
Fkbp15	A	G	4: 62,345,546	F95L	probably benign	Het
Fkbp6	A	T	5: 135,339,920		probably null	Het
Fmo9	T	C	1: 166,664,601	K367E	possibly damaging	Het
Gad2	T	C	2: 22,690,249	V554A	probably benign	Het
Gm18025	T	C	12: 34,290,632	D154G	probably benign	Het
Gm4353	A	G	7: 116,084,458	F34S	possibly damaging	Het
Gucy2e	A	G	11: 69,232,696	I459T	probably benign	Het
Hpx	A	G	7: 105,591,788	I426T	possibly damaging	Het
Hspa9	T	C	18: 34,943,174	T362A	possibly damaging	Het
Insr	G	A	8: 3,155,976	P1271L	probably damaging	Het
Jarid2	G	A	13: 44,902,301	V328I	possibly damaging	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif18b	A	G	11: 102,913,048	S429P	probably benign	Het
Lmnb1	T	A	18: 56,740,786	D421E	possibly damaging	Het
Lrp4	T	C	2: 91,492,615	I1148T	probably damaging	Het
Map1b	T	A	13: 99,432,824	M1130L	unknown	Het
Mlip	G	A	9: 77,230,482	S381L	probably damaging	Het
Myh6	T	C	14: 54,958,680	Y554C	probably damaging	Het
Myl4	T	C	11: 104,583,980	F52L	probably damaging	Het
Nol12	C	T	15: 78,940,480	T169I	probably benign	Het
Nrde2	C	T	12: 100,132,287	R707H	probably benign	Het
Oasl1	G	A	5: 114,936,978	V366M	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,599	I289T	possibly damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polrmt	C	T	10: 79,738,323		probably null	Het
Ppil4	A	G	10: 7,810,410	D344G	probably null	Het
Ppp2r3d	C	T	9: 124,422,765	A69T	possibly damaging	Het
Prmt3	C	T	7: 49,848,806	P487S	probably damaging	Het
Ptprm	A	T	17: 66,689,465	L1209H	probably damaging	Het
Rnf115	G	A	3: 96,727,848		probably benign	Het
Sec63	A	G	10: 42,796,245	D185G	possibly damaging	Het
Sema4b	T	C	7: 80,224,958	S699P	probably damaging	Het
Serpinb3d	T	G	1: 107,078,359	E333A	probably damaging	Het
Sh3rf2	T	C	18: 42,141,047	L426P	possibly damaging	Het
Slco6d1	A	G	1: 98,499,778	I611M	probably damaging	Het
Stk31	T	A	6: 49,417,285	Y194N	probably damaging	Het
Tlr9	G	A	9: 106,222,707		probably null	Het
Ubqln3	G	A	7: 104,141,467	P472L	probably benign	Het
Vmn1r188	G	A	13: 22,088,086	G70D	possibly damaging	Het
Zfp318	A	G	17: 46,412,773	M1901V	probably benign	Het
Zfp407	A	T	18: 84,560,524	D821E	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTAGCAGAAGCCGACAATG -3'
(R):5'- TCTCATTCAGTGTTGAAGCCAC -3'

Sequencing Primer
(F):5'- CGACAATGAGTGGGTGGTCC -3'
(R):5'- GAAGCCACTGTAAATTGTACTGC -3'

Posted On

2016-12-20