Incidental Mutation 'R0548:Wdr20rt'
ID44988
Institutional Source Beutler Lab
Gene Symbol Wdr20rt
Ensembl Gene ENSMUSG00000035560
Gene NameWD repeat domain 20, retrogene
Synonyms4921538B03Rik, Wdr20b, 4930427E19Rik
MMRRC Submission 038740-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R0548 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location65225517-65233359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65227315 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 344 (D344E)
Ref Sequence ENSEMBL: ENSMUSP00000152626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046331] [ENSMUST00000221658] [ENSMUST00000221980] [ENSMUST00000222822]
Predicted Effect probably benign
Transcript: ENSMUST00000046331
AA Change: D517E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036682
Gene: ENSMUSG00000035560
AA Change: D517E

DomainStartEndE-ValueType
WD40 140 178 1.33e1 SMART
WD40 205 246 1.38e-2 SMART
WD40 249 288 1.57e-6 SMART
WD40 291 380 8.29e-1 SMART
low complexity region 465 478 N/A INTRINSIC
Blast:WD40 480 557 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000221658
Predicted Effect probably benign
Transcript: ENSMUST00000221980
AA Change: D344E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000222822
AA Change: D416E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdk5rap2 A T 4: 70,349,142 probably null Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Map1b T C 13: 99,431,683 K1510R unknown Het
Marco T C 1: 120,492,038 T187A probably benign Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mmp15 T C 8: 95,372,351 V602A probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Olfr437 T A 6: 43,167,187 I43K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tars2 T C 3: 95,742,659 D470G probably damaging Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Wdr20rt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Wdr20rt APN 12 65225970 missense possibly damaging 0.95
IGL02142:Wdr20rt APN 12 65227265 missense probably benign 0.22
IGL02938:Wdr20rt APN 12 65225918 missense probably benign 0.01
R0501:Wdr20rt UTSW 12 65225807 missense probably benign 0.02
R0652:Wdr20rt UTSW 12 65225915 missense probably damaging 0.98
R1715:Wdr20rt UTSW 12 65227314 missense probably damaging 0.98
R1733:Wdr20rt UTSW 12 65227281 missense possibly damaging 0.87
R1851:Wdr20rt UTSW 12 65227151 missense possibly damaging 0.89
R2010:Wdr20rt UTSW 12 65227214 missense possibly damaging 0.88
R2214:Wdr20rt UTSW 12 65227413 missense probably damaging 1.00
R2254:Wdr20rt UTSW 12 65226233 missense probably damaging 1.00
R4793:Wdr20rt UTSW 12 65226621 missense probably damaging 0.99
R5169:Wdr20rt UTSW 12 65227410 missense probably damaging 0.99
R6238:Wdr20rt UTSW 12 65226190 start gained probably benign
R7018:Wdr20rt UTSW 12 65225762 utr 5 prime probably null
R7143:Wdr20rt UTSW 12 65225918 missense probably benign 0.08
R7707:Wdr20rt UTSW 12 65226207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAATAGCCTTCCACATTCAGCAG -3'
(R):5'- GGTGCAGCATTCAGGGTTGAAAC -3'

Sequencing Primer
(F):5'- TCATGGACGGGGCCATTAC -3'
(R):5'- GCATTCAGGGTTGAAACTTACTAAC -3'
Posted On2013-06-11