Mutagenetix > Incidental Mutations

Incidental Mutation 'R5820:Canx'

449880

Institutional Source

Beutler Lab

Gene Symbol

Canx

Ensembl Gene

ENSMUSG00000020368

Gene Name

calnexin

Synonyms

1110069N15Rik, CNX

MMRRC Submission

043400-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R5820 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50293961-50325673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50308383 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 153 (V153A)

Ref Sequence

ENSEMBL: ENSMUSP00000137440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020637
AA Change: V153A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: V153A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	72	441	1.7e-170	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000179865
AA Change: V153A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: V153A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	70	441	4.7e-166	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,039,526	V875A	probably benign	Het
Abcc4	A	G	14: 118,604,195	Y596H	probably benign	Het
Adgrg3	A	T	8: 95,039,593	M351L	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef38	A	T	3: 133,160,799	D192E	probably benign	Het
Arhgef40	T	C	14: 51,987,496	F33L	possibly damaging	Het
Arid1b	A	G	17: 4,996,254	Y439C	possibly damaging	Het
Bop1	G	A	15: 76,454,841	P386S	probably damaging	Het
Cacna1s	A	G	1: 136,079,604	H453R	probably damaging	Het
Chfr	T	A	5: 110,162,739	D475E	possibly damaging	Het
Clcn7	A	C	17: 25,149,052	K208T	probably damaging	Het
Cmya5	G	T	13: 93,092,780	N1933K	probably benign	Het
CN725425	A	G	15: 91,260,697	T588A	possibly damaging	Het
Cwh43	G	A	5: 73,428,632	W358*	probably null	Het
Cyfip2	A	T	11: 46,200,704	W1130R	probably damaging	Het
Ddx60	A	T	8: 61,956,121	D397V	possibly damaging	Het
Disp1	T	C	1: 183,135,587	S92G	probably benign	Het
Dusp6	A	G	10: 99,264,002	D104G	possibly damaging	Het
Dzank1	C	T	2: 144,513,488	V96M	probably damaging	Het
Ecscr	C	A	18: 35,717,267	V52F	possibly damaging	Het
Epha7	A	T	4: 28,949,365	N712I	probably damaging	Het
Eva1a	C	T	6: 82,071,173	P11S	probably benign	Het
Fam187b	T	C	7: 30,977,152	C29R	probably damaging	Het
Fau	T	C	19: 6,059,422	V117A	probably benign	Het
Fbxw11	A	G	11: 32,735,374	D369G	probably damaging	Het
Fkbp15	A	G	4: 62,345,546	F95L	probably benign	Het
Fkbp6	A	T	5: 135,339,920		probably null	Het
Fmo9	T	C	1: 166,664,601	K367E	possibly damaging	Het
Gad2	T	C	2: 22,690,249	V554A	probably benign	Het
Gm18025	T	C	12: 34,290,632	D154G	probably benign	Het
Gm4353	A	G	7: 116,084,458	F34S	possibly damaging	Het
Gucy2e	A	G	11: 69,232,696	I459T	probably benign	Het
Hpx	A	G	7: 105,591,788	I426T	possibly damaging	Het
Hspa9	T	C	18: 34,943,174	T362A	possibly damaging	Het
Insr	G	A	8: 3,155,976	P1271L	probably damaging	Het
Jarid2	G	A	13: 44,902,301	V328I	possibly damaging	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif18b	A	G	11: 102,913,048	S429P	probably benign	Het
Lats1	A	T	10: 7,705,908	H819L	probably damaging	Het
Lmnb1	T	A	18: 56,740,786	D421E	possibly damaging	Het
Lrp4	T	C	2: 91,492,615	I1148T	probably damaging	Het
Map1b	T	A	13: 99,432,824	M1130L	unknown	Het
Mlip	G	A	9: 77,230,482	S381L	probably damaging	Het
Myh6	T	C	14: 54,958,680	Y554C	probably damaging	Het
Myl4	T	C	11: 104,583,980	F52L	probably damaging	Het
Nol12	C	T	15: 78,940,480	T169I	probably benign	Het
Nrde2	C	T	12: 100,132,287	R707H	probably benign	Het
Oasl1	G	A	5: 114,936,978	V366M	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,599	I289T	possibly damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polrmt	C	T	10: 79,738,323		probably null	Het
Ppil4	A	G	10: 7,810,410	D344G	probably null	Het
Ppp2r3d	C	T	9: 124,422,765	A69T	possibly damaging	Het
Prmt3	C	T	7: 49,848,806	P487S	probably damaging	Het
Ptprm	A	T	17: 66,689,465	L1209H	probably damaging	Het
Rnf115	G	A	3: 96,727,848		probably benign	Het
Sec63	A	G	10: 42,796,245	D185G	possibly damaging	Het
Sema4b	T	C	7: 80,224,958	S699P	probably damaging	Het
Serpinb3d	T	G	1: 107,078,359	E333A	probably damaging	Het
Sh3rf2	T	C	18: 42,141,047	L426P	possibly damaging	Het
Slco6d1	A	G	1: 98,499,778	I611M	probably damaging	Het
Stk31	T	A	6: 49,417,285	Y194N	probably damaging	Het
Tlr9	G	A	9: 106,222,707		probably null	Het
Ubqln3	G	A	7: 104,141,467	P472L	probably benign	Het
Vmn1r188	G	A	13: 22,088,086	G70D	possibly damaging	Het
Zfp318	A	G	17: 46,412,773	M1901V	probably benign	Het
Zfp407	A	T	18: 84,560,524	D821E	probably benign	Het

Other mutations in Canx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Canx	APN	11	50300996	missense	possibly damaging	0.61
IGL03089:Canx	APN	11	50304482	missense	possibly damaging	0.85
R1428:Canx	UTSW	11	50308394	splice site	probably benign
R1876:Canx	UTSW	11	50304359	missense	probably damaging	1.00
R2057:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2058:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2088:Canx	UTSW	11	50310390	missense	possibly damaging	0.89
R2126:Canx	UTSW	11	50304358	missense	probably damaging	1.00
R2217:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2218:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2386:Canx	UTSW	11	50297106	missense	probably benign
R3716:Canx	UTSW	11	50304474	missense	probably benign	0.14
R3957:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R4019:Canx	UTSW	11	50299245	missense	probably damaging	1.00
R4402:Canx	UTSW	11	50304438	missense	probably benign	0.13
R4825:Canx	UTSW	11	50308809	missense	probably benign	0.42
R5252:Canx	UTSW	11	50308794	missense	probably damaging	1.00
R5385:Canx	UTSW	11	50301812	missense	probably damaging	1.00
R5797:Canx	UTSW	11	50301017	missense	probably benign	0.00
R6052:Canx	UTSW	11	50297119	missense	possibly damaging	0.49
R7259:Canx	UTSW	11	50301816	missense	probably damaging	1.00
R7603:Canx	UTSW	11	50311628	missense	probably benign
R7715:Canx	UTSW	11	50310804	missense	probably benign	0.13
R7735:Canx	UTSW	11	50301039	missense	probably damaging	0.97
R8063:Canx	UTSW	11	50308346	nonsense	probably null
R8069:Canx	UTSW	11	50311704	missense	possibly damaging	0.93
R8494:Canx	UTSW	11	50311782	critical splice acceptor site	probably null
R8508:Canx	UTSW	11	50311647	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- ACCAGCAGCAGCATTTCTTTTC -3'
(R):5'- GCAAACAAATGTCTGGCTTTTGC -3'

Sequencing Primer
(F):5'- CAGCAGCAGCATTTCTTTTCATAGG -3'
(R):5'- TTTTTGATTTTTGTGTGGCCGAG -3'

Posted On

2016-12-20