Incidental Mutation 'R5820:Gucy2e'
ID449881
Institutional Source Beutler Lab
Gene Symbol Gucy2e
Ensembl Gene ENSMUSG00000020890
Gene Nameguanylate cyclase 2e
SynonymsGC1, GC-E, ROS-GC1
MMRRC Submission 043400-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5820 (G1)
Quality Score188
Status Not validated
Chromosome11
Chromosomal Location69218117-69237036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69232696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 459 (I459T)
Ref Sequence ENSEMBL: ENSMUSP00000104305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021259] [ENSMUST00000108664] [ENSMUST00000108665]
Predicted Effect probably benign
Transcript: ENSMUST00000021259
AA Change: I459T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021259
Gene: ENSMUSG00000020890
AA Change: I459T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108664
AA Change: I459T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104304
Gene: ENSMUSG00000020890
AA Change: I459T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 2.4e-40 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 560 807 9.5e-23 PFAM
Pfam:Pkinase_Tyr 560 807 7.7e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108665
AA Change: I459T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104305
Gene: ENSMUSG00000020890
AA Change: I459T

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
Pfam:ANF_receptor 75 403 5.3e-37 PFAM
transmembrane domain 468 490 N/A INTRINSIC
Pfam:Pkinase 557 807 1.1e-24 PFAM
Pfam:Pkinase_Tyr 560 807 2e-29 PFAM
CYCc 847 1050 7.78e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155457
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal retinal cone cell morphology, impaired cone and rod electrophysiology, and severe retinal cone cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,039,526 V875A probably benign Het
Abcc4 A G 14: 118,604,195 Y596H probably benign Het
Adgrg3 A T 8: 95,039,593 M351L possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef38 A T 3: 133,160,799 D192E probably benign Het
Arhgef40 T C 14: 51,987,496 F33L possibly damaging Het
Arid1b A G 17: 4,996,254 Y439C possibly damaging Het
Bop1 G A 15: 76,454,841 P386S probably damaging Het
Cacna1s A G 1: 136,079,604 H453R probably damaging Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Chfr T A 5: 110,162,739 D475E possibly damaging Het
Clcn7 A C 17: 25,149,052 K208T probably damaging Het
Cmya5 G T 13: 93,092,780 N1933K probably benign Het
CN725425 A G 15: 91,260,697 T588A possibly damaging Het
Cwh43 G A 5: 73,428,632 W358* probably null Het
Cyfip2 A T 11: 46,200,704 W1130R probably damaging Het
Ddx60 A T 8: 61,956,121 D397V possibly damaging Het
Disp1 T C 1: 183,135,587 S92G probably benign Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Dzank1 C T 2: 144,513,488 V96M probably damaging Het
Ecscr C A 18: 35,717,267 V52F possibly damaging Het
Epha7 A T 4: 28,949,365 N712I probably damaging Het
Eva1a C T 6: 82,071,173 P11S probably benign Het
Fam187b T C 7: 30,977,152 C29R probably damaging Het
Fau T C 19: 6,059,422 V117A probably benign Het
Fbxw11 A G 11: 32,735,374 D369G probably damaging Het
Fkbp15 A G 4: 62,345,546 F95L probably benign Het
Fkbp6 A T 5: 135,339,920 probably null Het
Fmo9 T C 1: 166,664,601 K367E possibly damaging Het
Gad2 T C 2: 22,690,249 V554A probably benign Het
Gm18025 T C 12: 34,290,632 D154G probably benign Het
Gm4353 A G 7: 116,084,458 F34S possibly damaging Het
Hpx A G 7: 105,591,788 I426T possibly damaging Het
Hspa9 T C 18: 34,943,174 T362A possibly damaging Het
Insr G A 8: 3,155,976 P1271L probably damaging Het
Jarid2 G A 13: 44,902,301 V328I possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif18b A G 11: 102,913,048 S429P probably benign Het
Lats1 A T 10: 7,705,908 H819L probably damaging Het
Lmnb1 T A 18: 56,740,786 D421E possibly damaging Het
Lrp4 T C 2: 91,492,615 I1148T probably damaging Het
Map1b T A 13: 99,432,824 M1130L unknown Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Myh6 T C 14: 54,958,680 Y554C probably damaging Het
Myl4 T C 11: 104,583,980 F52L probably damaging Het
Nol12 C T 15: 78,940,480 T169I probably benign Het
Nrde2 C T 12: 100,132,287 R707H probably benign Het
Oasl1 G A 5: 114,936,978 V366M possibly damaging Het
Olfr911-ps1 T C 9: 38,524,599 I289T possibly damaging Het
Otogl G A 10: 107,777,117 silent Het
Polrmt C T 10: 79,738,323 probably null Het
Ppil4 A G 10: 7,810,410 D344G probably null Het
Ppp2r3d C T 9: 124,422,765 A69T possibly damaging Het
Prmt3 C T 7: 49,848,806 P487S probably damaging Het
Ptprm A T 17: 66,689,465 L1209H probably damaging Het
Rnf115 G A 3: 96,727,848 probably benign Het
Sec63 A G 10: 42,796,245 D185G possibly damaging Het
Sema4b T C 7: 80,224,958 S699P probably damaging Het
Serpinb3d T G 1: 107,078,359 E333A probably damaging Het
Sh3rf2 T C 18: 42,141,047 L426P possibly damaging Het
Slco6d1 A G 1: 98,499,778 I611M probably damaging Het
Stk31 T A 6: 49,417,285 Y194N probably damaging Het
Tlr9 G A 9: 106,222,707 probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn1r188 G A 13: 22,088,086 G70D possibly damaging Het
Zfp318 A G 17: 46,412,773 M1901V probably benign Het
Zfp407 A T 18: 84,560,524 D821E probably benign Het
Other mutations in Gucy2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Gucy2e APN 11 69223097 missense possibly damaging 0.88
IGL01626:Gucy2e APN 11 69232855 missense possibly damaging 0.80
IGL01756:Gucy2e APN 11 69232852 missense probably damaging 0.98
IGL02030:Gucy2e APN 11 69223816 missense probably damaging 1.00
IGL02095:Gucy2e APN 11 69232787 missense possibly damaging 0.48
IGL02387:Gucy2e APN 11 69236116 missense probably benign
IGL02622:Gucy2e APN 11 69225031 missense probably damaging 1.00
IGL02660:Gucy2e APN 11 69232007 missense probably benign 0.18
IGL03181:Gucy2e APN 11 69230182 splice site probably benign
R0110:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0115:Gucy2e UTSW 11 69236632 missense unknown
R0450:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0469:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R0497:Gucy2e UTSW 11 69224159 missense probably damaging 1.00
R0510:Gucy2e UTSW 11 69235576 missense probably benign 0.00
R1252:Gucy2e UTSW 11 69235659 missense probably benign
R1535:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
R1700:Gucy2e UTSW 11 69232058 missense probably benign
R2035:Gucy2e UTSW 11 69227532 missense probably benign 0.12
R2179:Gucy2e UTSW 11 69228578 splice site probably null
R3622:Gucy2e UTSW 11 69225051 missense probably damaging 1.00
R4212:Gucy2e UTSW 11 69228123 missense probably damaging 0.99
R4600:Gucy2e UTSW 11 69236168 missense possibly damaging 0.71
R4790:Gucy2e UTSW 11 69228448 missense probably damaging 1.00
R5170:Gucy2e UTSW 11 69235570 missense probably damaging 0.97
R5174:Gucy2e UTSW 11 69236566 missense probably benign
R5440:Gucy2e UTSW 11 69223646 missense probably damaging 0.98
R5586:Gucy2e UTSW 11 69226256 missense probably damaging 1.00
R5668:Gucy2e UTSW 11 69228381 missense probably damaging 1.00
R5826:Gucy2e UTSW 11 69236033 missense possibly damaging 0.53
R6169:Gucy2e UTSW 11 69236104 missense probably benign 0.19
R6544:Gucy2e UTSW 11 69235657 missense probably benign
R6815:Gucy2e UTSW 11 69232001 missense possibly damaging 0.86
R7020:Gucy2e UTSW 11 69232793 missense probably benign 0.00
R7592:Gucy2e UTSW 11 69223324 critical splice donor site probably null
R7658:Gucy2e UTSW 11 69226229 nonsense probably null
R7812:Gucy2e UTSW 11 69226243 missense probably damaging 1.00
X0025:Gucy2e UTSW 11 69226244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGCCAAATCTCGGGAGCTG -3'
(R):5'- TCCTTTGTGCTGCTGGACAC -3'

Sequencing Primer
(F):5'- TTACAGATTCCTCAAAGGGGAAGTC -3'
(R):5'- TGGACACAGATGCATCCG -3'
Posted On2016-12-20