Mutagenetix > Incidental Mutations

Incidental Mutation 'R5820:Jarid2'

449888

Institutional Source

Beutler Lab

Gene Symbol

Jarid2

Ensembl Gene

ENSMUSG00000038518

Gene Name

jumonji, AT rich interactive domain 2

Synonyms

jumonji, Jmj

MMRRC Submission

043400-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5820 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44729474-44921643 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44902301 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 328 (V328I)

Ref Sequence

ENSEMBL: ENSMUSP00000134675 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044608
AA Change: V328I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: V328I

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173246
AA Change: V328I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: V328I

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173367
AA Change: V189I

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518
AA Change: V189I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
low complexity region	126	146	N/A	INTRINSIC
low complexity region	195	214	N/A	INTRINSIC
JmjN	415	456	1.77e-20	SMART
PDB:2RQ5\|A	476	507	3e-14	PDB
Blast:ARID	477	507	2e-14	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173704
AA Change: V328I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: V328I

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1190	1e-10	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173906
AA Change: V290I

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: V290I

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	143	157	N/A	INTRINSIC
low complexity region	227	247	N/A	INTRINSIC
low complexity region	296	315	N/A	INTRINSIC
JmjN	516	557	1.77e-20	SMART
ARID	578	669	4.96e-24	SMART
BRIGHT	582	674	1.7e-29	SMART
low complexity region	753	762	N/A	INTRINSIC
JmjC	844	1008	1.04e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174683

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,039,526	V875A	probably benign	Het
Abcc4	A	G	14: 118,604,195	Y596H	probably benign	Het
Adgrg3	A	T	8: 95,039,593	M351L	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef38	A	T	3: 133,160,799	D192E	probably benign	Het
Arhgef40	T	C	14: 51,987,496	F33L	possibly damaging	Het
Arid1b	A	G	17: 4,996,254	Y439C	possibly damaging	Het
Bop1	G	A	15: 76,454,841	P386S	probably damaging	Het
Cacna1s	A	G	1: 136,079,604	H453R	probably damaging	Het
Canx	A	G	11: 50,308,383	V153A	probably damaging	Het
Chfr	T	A	5: 110,162,739	D475E	possibly damaging	Het
Clcn7	A	C	17: 25,149,052	K208T	probably damaging	Het
Cmya5	G	T	13: 93,092,780	N1933K	probably benign	Het
CN725425	A	G	15: 91,260,697	T588A	possibly damaging	Het
Cwh43	G	A	5: 73,428,632	W358*	probably null	Het
Cyfip2	A	T	11: 46,200,704	W1130R	probably damaging	Het
Ddx60	A	T	8: 61,956,121	D397V	possibly damaging	Het
Disp1	T	C	1: 183,135,587	S92G	probably benign	Het
Dusp6	A	G	10: 99,264,002	D104G	possibly damaging	Het
Dzank1	C	T	2: 144,513,488	V96M	probably damaging	Het
Ecscr	C	A	18: 35,717,267	V52F	possibly damaging	Het
Epha7	A	T	4: 28,949,365	N712I	probably damaging	Het
Eva1a	C	T	6: 82,071,173	P11S	probably benign	Het
Fam187b	T	C	7: 30,977,152	C29R	probably damaging	Het
Fau	T	C	19: 6,059,422	V117A	probably benign	Het
Fbxw11	A	G	11: 32,735,374	D369G	probably damaging	Het
Fkbp15	A	G	4: 62,345,546	F95L	probably benign	Het
Fkbp6	A	T	5: 135,339,920		probably null	Het
Fmo9	T	C	1: 166,664,601	K367E	possibly damaging	Het
Gad2	T	C	2: 22,690,249	V554A	probably benign	Het
Gm18025	T	C	12: 34,290,632	D154G	probably benign	Het
Gm4353	A	G	7: 116,084,458	F34S	possibly damaging	Het
Gucy2e	A	G	11: 69,232,696	I459T	probably benign	Het
Hpx	A	G	7: 105,591,788	I426T	possibly damaging	Het
Hspa9	T	C	18: 34,943,174	T362A	possibly damaging	Het
Insr	G	A	8: 3,155,976	P1271L	probably damaging	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kif18b	A	G	11: 102,913,048	S429P	probably benign	Het
Lats1	A	T	10: 7,705,908	H819L	probably damaging	Het
Lmnb1	T	A	18: 56,740,786	D421E	possibly damaging	Het
Lrp4	T	C	2: 91,492,615	I1148T	probably damaging	Het
Map1b	T	A	13: 99,432,824	M1130L	unknown	Het
Mlip	G	A	9: 77,230,482	S381L	probably damaging	Het
Myh6	T	C	14: 54,958,680	Y554C	probably damaging	Het
Myl4	T	C	11: 104,583,980	F52L	probably damaging	Het
Nol12	C	T	15: 78,940,480	T169I	probably benign	Het
Nrde2	C	T	12: 100,132,287	R707H	probably benign	Het
Oasl1	G	A	5: 114,936,978	V366M	possibly damaging	Het
Olfr911-ps1	T	C	9: 38,524,599	I289T	possibly damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polrmt	C	T	10: 79,738,323		probably null	Het
Ppil4	A	G	10: 7,810,410	D344G	probably null	Het
Ppp2r3d	C	T	9: 124,422,765	A69T	possibly damaging	Het
Prmt3	C	T	7: 49,848,806	P487S	probably damaging	Het
Ptprm	A	T	17: 66,689,465	L1209H	probably damaging	Het
Rnf115	G	A	3: 96,727,848		probably benign	Het
Sec63	A	G	10: 42,796,245	D185G	possibly damaging	Het
Sema4b	T	C	7: 80,224,958	S699P	probably damaging	Het
Serpinb3d	T	G	1: 107,078,359	E333A	probably damaging	Het
Sh3rf2	T	C	18: 42,141,047	L426P	possibly damaging	Het
Slco6d1	A	G	1: 98,499,778	I611M	probably damaging	Het
Stk31	T	A	6: 49,417,285	Y194N	probably damaging	Het
Tlr9	G	A	9: 106,222,707		probably null	Het
Ubqln3	G	A	7: 104,141,467	P472L	probably benign	Het
Vmn1r188	G	A	13: 22,088,086	G70D	possibly damaging	Het
Zfp318	A	G	17: 46,412,773	M1901V	probably benign	Het
Zfp407	A	T	18: 84,560,524	D821E	probably benign	Het

Other mutations in Jarid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01572:Jarid2	APN	13	44884835	missense	probably damaging	1.00
IGL02217:Jarid2	APN	13	44913201	missense	probably damaging	1.00
IGL02378:Jarid2	APN	13	44914325	missense	probably damaging	0.98
IGL02604:Jarid2	APN	13	44874401	missense	probably damaging	1.00
IGL02865:Jarid2	APN	13	44910560	missense	probably damaging	1.00
IGL02926:Jarid2	APN	13	44902929	missense	probably benign	0.03
R0057:Jarid2	UTSW	13	44884856	missense	probably damaging	0.96
R0426:Jarid2	UTSW	13	44840882	critical splice donor site	probably null
R0545:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R0562:Jarid2	UTSW	13	44902359	missense	probably damaging	0.99
R1192:Jarid2	UTSW	13	44906545	missense	probably damaging	1.00
R1241:Jarid2	UTSW	13	44884892	splice site	probably benign
R1254:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1552:Jarid2	UTSW	13	44911199	missense	probably damaging	1.00
R1728:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1729:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1730:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1739:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1783:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1785:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1844:Jarid2	UTSW	13	44902743	missense	possibly damaging	0.71
R1896:Jarid2	UTSW	13	44884882	critical splice donor site	probably null
R1965:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1966:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1995:Jarid2	UTSW	13	44874441	missense	probably damaging	1.00
R2120:Jarid2	UTSW	13	44906336	missense	probably benign	0.17
R2142:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2172:Jarid2	UTSW	13	44902539	missense	probably damaging	0.99
R2242:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2245:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3110:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3111:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3112:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3115:Jarid2	UTSW	13	44896466	missense	probably damaging	1.00
R3620:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3704:Jarid2	UTSW	13	44902355	missense	probably benign
R3802:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R3804:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R4126:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4127:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4128:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4153:Jarid2	UTSW	13	44910426	missense	probably damaging	1.00
R4844:Jarid2	UTSW	13	44913772	missense	probably damaging	0.96
R5044:Jarid2	UTSW	13	44906565	missense	probably damaging	1.00
R5329:Jarid2	UTSW	13	44906271	missense	possibly damaging	0.49
R5632:Jarid2	UTSW	13	44896290	missense	probably damaging	0.97
R6267:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6296:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6479:Jarid2	UTSW	13	44848289	missense	probably benign	0.22
R6619:Jarid2	UTSW	13	44874396	missense	probably damaging	1.00
R6633:Jarid2	UTSW	13	44884877	missense	probably damaging	0.97
R6970:Jarid2	UTSW	13	44902985	missense	probably damaging	1.00
R7020:Jarid2	UTSW	13	44884824	missense	probably damaging	1.00
R7155:Jarid2	UTSW	13	44902462	missense	probably damaging	1.00
R7223:Jarid2	UTSW	13	44896322	missense	possibly damaging	0.89
R7265:Jarid2	UTSW	13	44902272	missense	probably benign	0.29
R8321:Jarid2	UTSW	13	44848386	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTCTTCTGAGCCAGCAACTG -3'
(R):5'- TTTGGGTTCAACCTGCTGC -3'

Sequencing Primer
(F):5'- TCTTCTGAGCCAGCAACTGTAGAAG -3'
(R):5'- CAAGGGATAGCACCTGTTTGC -3'

Posted On

2016-12-20