Incidental Mutation 'R5820:Myh6'
ID449892
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission 043400-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5820 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54958680 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 554 (Y554C)
Ref Sequence ENSEMBL: ENSMUSP00000154634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably damaging
Transcript: ENSMUST00000081857
AA Change: Y554C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: Y554C

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131892
Predicted Effect probably damaging
Transcript: ENSMUST00000145322
AA Change: Y554C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115326
Gene: ENSMUSG00000040752
AA Change: Y554C

DomainStartEndE-ValueType
Pfam:Myosin_N 34 75 5.3e-17 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
coiled coil region 842 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226297
AA Change: Y554C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,039,526 V875A probably benign Het
Abcc4 A G 14: 118,604,195 Y596H probably benign Het
Adgrg3 A T 8: 95,039,593 M351L possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef38 A T 3: 133,160,799 D192E probably benign Het
Arhgef40 T C 14: 51,987,496 F33L possibly damaging Het
Arid1b A G 17: 4,996,254 Y439C possibly damaging Het
Bop1 G A 15: 76,454,841 P386S probably damaging Het
Cacna1s A G 1: 136,079,604 H453R probably damaging Het
Canx A G 11: 50,308,383 V153A probably damaging Het
Chfr T A 5: 110,162,739 D475E possibly damaging Het
Clcn7 A C 17: 25,149,052 K208T probably damaging Het
Cmya5 G T 13: 93,092,780 N1933K probably benign Het
CN725425 A G 15: 91,260,697 T588A possibly damaging Het
Cwh43 G A 5: 73,428,632 W358* probably null Het
Cyfip2 A T 11: 46,200,704 W1130R probably damaging Het
Ddx60 A T 8: 61,956,121 D397V possibly damaging Het
Disp1 T C 1: 183,135,587 S92G probably benign Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Dzank1 C T 2: 144,513,488 V96M probably damaging Het
Ecscr C A 18: 35,717,267 V52F possibly damaging Het
Epha7 A T 4: 28,949,365 N712I probably damaging Het
Eva1a C T 6: 82,071,173 P11S probably benign Het
Fam187b T C 7: 30,977,152 C29R probably damaging Het
Fau T C 19: 6,059,422 V117A probably benign Het
Fbxw11 A G 11: 32,735,374 D369G probably damaging Het
Fkbp15 A G 4: 62,345,546 F95L probably benign Het
Fkbp6 A T 5: 135,339,920 probably null Het
Fmo9 T C 1: 166,664,601 K367E possibly damaging Het
Gad2 T C 2: 22,690,249 V554A probably benign Het
Gm18025 T C 12: 34,290,632 D154G probably benign Het
Gm4353 A G 7: 116,084,458 F34S possibly damaging Het
Gucy2e A G 11: 69,232,696 I459T probably benign Het
Hpx A G 7: 105,591,788 I426T possibly damaging Het
Hspa9 T C 18: 34,943,174 T362A possibly damaging Het
Insr G A 8: 3,155,976 P1271L probably damaging Het
Jarid2 G A 13: 44,902,301 V328I possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif18b A G 11: 102,913,048 S429P probably benign Het
Lats1 A T 10: 7,705,908 H819L probably damaging Het
Lmnb1 T A 18: 56,740,786 D421E possibly damaging Het
Lrp4 T C 2: 91,492,615 I1148T probably damaging Het
Map1b T A 13: 99,432,824 M1130L unknown Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Myl4 T C 11: 104,583,980 F52L probably damaging Het
Nol12 C T 15: 78,940,480 T169I probably benign Het
Nrde2 C T 12: 100,132,287 R707H probably benign Het
Oasl1 G A 5: 114,936,978 V366M possibly damaging Het
Olfr911-ps1 T C 9: 38,524,599 I289T possibly damaging Het
Otogl G A 10: 107,777,117 silent Het
Polrmt C T 10: 79,738,323 probably null Het
Ppil4 A G 10: 7,810,410 D344G probably null Het
Ppp2r3d C T 9: 124,422,765 A69T possibly damaging Het
Prmt3 C T 7: 49,848,806 P487S probably damaging Het
Ptprm A T 17: 66,689,465 L1209H probably damaging Het
Rnf115 G A 3: 96,727,848 probably benign Het
Sec63 A G 10: 42,796,245 D185G possibly damaging Het
Sema4b T C 7: 80,224,958 S699P probably damaging Het
Serpinb3d T G 1: 107,078,359 E333A probably damaging Het
Sh3rf2 T C 18: 42,141,047 L426P possibly damaging Het
Slco6d1 A G 1: 98,499,778 I611M probably damaging Het
Stk31 T A 6: 49,417,285 Y194N probably damaging Het
Tlr9 G A 9: 106,222,707 probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Vmn1r188 G A 13: 22,088,086 G70D possibly damaging Het
Zfp318 A G 17: 46,412,773 M1901V probably benign Het
Zfp407 A T 18: 84,560,524 D821E probably benign Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
R7851:Myh6 UTSW 14 54953051 missense possibly damaging 0.94
R7934:Myh6 UTSW 14 54953051 missense possibly damaging 0.94
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGACTTCTGGTACAAACC -3'
(R):5'- TCTTGGGCCAAGAGGTTCTG -3'

Sequencing Primer
(F):5'- CCACCACCGTCTCATTGAGTG -3'
(R):5'- TTGACCCTTCAGCAGTGCAG -3'
Posted On2016-12-20