Incidental Mutation 'R0548:Map1b'
ID44991
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Namemicrotubule-associated protein 1B
SynonymsMtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission 038740-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0548 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location99421446-99516540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99431683 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1510 (K1510R)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: K1510R
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: K1510R

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdk5rap2 A T 4: 70,349,142 probably null Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Marco T C 1: 120,492,038 T187A probably benign Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mmp15 T C 8: 95,372,351 V602A probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Olfr437 T A 6: 43,167,187 I43K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tars2 T C 3: 95,742,659 D470G probably damaging Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Wdr20rt T A 12: 65,227,315 D344E probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CATGCAGAGAAGGAGACACGTCATC -3'
(R):5'- AATGGAAAGCAGGGCTTCCCAG -3'

Sequencing Primer
(F):5'- AGACACGTCATCTGTGGTTG -3'
(R):5'- GAAAGCCCAGTTTCTGACCTG -3'
Posted On2013-06-11