Incidental Mutation 'R5821:Clasp1'
ID449911
Institutional Source Beutler Lab
Gene Symbol Clasp1
Ensembl Gene ENSMUSG00000064302
Gene NameCLIP associating protein 1
Synonyms1700030C23Rik, B130045P17Rik, CLASP1, mCLASP1, 5730583A19Rik, CLASP1alpha
MMRRC Submission 043401-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5821 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location118389058-118612678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118590484 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1087 (F1087I)
Ref Sequence ENSEMBL: ENSMUSP00000142203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049404] [ENSMUST00000070989] [ENSMUST00000165223] [ENSMUST00000178710] [ENSMUST00000185405] [ENSMUST00000186349] [ENSMUST00000187713] [ENSMUST00000188710] [ENSMUST00000189262] [ENSMUST00000189570] [ENSMUST00000189738] [ENSMUST00000190571] [ENSMUST00000190733] [ENSMUST00000191445] [ENSMUST00000191823] [ENSMUST00000204325]
Predicted Effect probably damaging
Transcript: ENSMUST00000049404
AA Change: F1379I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042266
Gene: ENSMUSG00000064302
AA Change: F1379I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070989
AA Change: F1369I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067858
Gene: ENSMUSG00000064302
AA Change: F1369I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 3.23e-1 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165223
AA Change: F1295I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128089
Gene: ENSMUSG00000064302
AA Change: F1295I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1056 3.23e-1 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178710
AA Change: F1302I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137137
Gene: ENSMUSG00000064302
AA Change: F1302I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1047 6.55e-2 SMART
low complexity region 1058 1075 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
TOG 1210 1448 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185405
AA Change: F1335I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139619
Gene: ENSMUSG00000064302
AA Change: F1335I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 769 783 N/A INTRINSIC
low complexity region 801 811 N/A INTRINSIC
TOG 827 1065 1.6e-5 SMART
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1166 1177 N/A INTRINSIC
TOG 1228 1466 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186349
AA Change: F1379I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141105
Gene: ENSMUSG00000064302
AA Change: F1379I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187713
AA Change: F1318I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139526
Gene: ENSMUSG00000064302
AA Change: F1318I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 768 782 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
TOG 826 1064 1.6e-5 SMART
low complexity region 1075 1092 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
TOG 1227 1465 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188710
AA Change: F1369I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140593
Gene: ENSMUSG00000064302
AA Change: F1369I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 818 832 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 1.6e-5 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189262
AA Change: F1303I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140860
Gene: ENSMUSG00000064302
AA Change: F1303I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
TOG 802 1040 1.6e-5 SMART
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
TOG 1203 1441 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189570
AA Change: F1311I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140167
Gene: ENSMUSG00000064302
AA Change: F1311I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1055 3.2e-6 SMART
low complexity region 1066 1083 N/A INTRINSIC
low complexity region 1156 1167 N/A INTRINSIC
TOG 1218 1456 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189738
AA Change: F1320I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140665
Gene: ENSMUSG00000064302
AA Change: F1320I

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1048 3.23e-1 SMART
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
TOG 1211 1449 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190571
AA Change: F1395I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140019
Gene: ENSMUSG00000064302
AA Change: F1395I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
low complexity region 805 819 N/A INTRINSIC
low complexity region 837 847 N/A INTRINSIC
TOG 863 1101 1.6e-5 SMART
low complexity region 1112 1129 N/A INTRINSIC
low complexity region 1150 1163 N/A INTRINSIC
low complexity region 1241 1252 N/A INTRINSIC
TOG 1303 1541 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190733
Predicted Effect probably damaging
Transcript: ENSMUST00000191445
AA Change: F1312I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140095
Gene: ENSMUSG00000064302
AA Change: F1312I

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 761 775 N/A INTRINSIC
low complexity region 793 803 N/A INTRINSIC
TOG 819 1056 3.2e-6 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191823
AA Change: F1087I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142203
Gene: ENSMUSG00000064302
AA Change: F1087I

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
TOG 87 319 5.6e-16 SMART
low complexity region 347 362 N/A INTRINSIC
low complexity region 374 401 N/A INTRINSIC
low complexity region 450 483 N/A INTRINSIC
low complexity region 537 551 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
TOG 594 832 1.6e-5 SMART
low complexity region 843 860 N/A INTRINSIC
low complexity region 933 944 N/A INTRINSIC
TOG 995 1233 2.4e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203646
Predicted Effect probably benign
Transcript: ENSMUST00000204325
Meta Mutation Damage Score 0.2914 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,446 V278D possibly damaging Het
Acacb A G 5: 114,184,106 D227G possibly damaging Het
Akap9 A G 5: 4,046,064 E2313G probably benign Het
Cchcr1 A T 17: 35,528,848 E564D probably damaging Het
Cers2 G A 3: 95,321,697 probably benign Het
Cfap161 A G 7: 83,775,980 I301T probably benign Het
Ciita A T 16: 10,511,805 E648V possibly damaging Het
Cir1 C T 2: 73,312,460 C10Y probably damaging Het
Cped1 C A 6: 22,138,682 F415L probably benign Het
Dnah7b A G 1: 46,142,132 T1060A possibly damaging Het
Epha5 G T 5: 84,084,728 P809H probably damaging Het
Fuca1 T A 4: 135,922,962 probably null Het
Gm20388 A T 8: 122,900,633 *98R probably null Het
Gm26796 G A 12: 80,758,790 R237C unknown Het
Idua A G 5: 108,679,734 Y138C probably benign Het
Ighd A T 12: 113,409,633 L240H probably benign Het
Ing2 C G 8: 47,668,826 C229S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kctd8 A T 5: 69,110,485 N427K probably benign Het
Kif16b T C 2: 142,702,666 E1147G probably damaging Het
Kif18a G A 2: 109,289,845 probably benign Het
Krt82 T A 15: 101,548,385 R187* probably null Het
Lrrk2 T C 15: 91,709,390 probably null Het
M1ap T C 6: 82,968,102 Y126H probably benign Het
Mmel1 A G 4: 154,885,587 N226D possibly damaging Het
Mtmr11 A G 3: 96,167,869 D353G possibly damaging Het
Nfkbia A T 12: 55,491,220 H149Q probably damaging Het
Nr5a1 A T 2: 38,708,499 F95L probably damaging Het
Nutm2 A G 13: 50,469,855 Y196C probably benign Het
Oxtr A G 6: 112,489,496 I101T probably damaging Het
Pcsk2 T A 2: 143,749,115 probably null Het
Pde5a T C 3: 122,817,955 I514T probably benign Het
Pign A G 1: 105,589,063 W585R possibly damaging Het
Pomgnt1 A G 4: 116,155,736 S407G probably benign Het
Ppfia3 G A 7: 45,353,616 T372I probably damaging Het
Prrc2b A T 2: 32,212,132 E739V probably damaging Het
Scn7a T C 2: 66,743,703 E192G probably damaging Het
Slmap T C 14: 26,462,280 D316G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tgm2 T A 2: 158,143,054 Y44F possibly damaging Het
Tmc8 C A 11: 117,792,629 S670* probably null Het
Tmem145 A G 7: 25,315,521 D523G probably benign Het
Trove2 A G 1: 143,766,765 V209A probably benign Het
Vmn2r115 G A 17: 23,347,963 G483E probably damaging Het
Other mutations in Clasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01786:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01871:Clasp1 APN 1 118570889 missense probably damaging 1.00
IGL02066:Clasp1 APN 1 118565260 critical splice donor site probably null
IGL02602:Clasp1 APN 1 118471785 missense probably damaging 0.99
IGL02683:Clasp1 APN 1 118539266 missense probably benign 0.33
IGL02728:Clasp1 APN 1 118602377 missense probably damaging 1.00
IGL02820:Clasp1 APN 1 118551104 missense possibly damaging 0.77
IGL02874:Clasp1 APN 1 118552043 missense possibly damaging 0.86
IGL02975:Clasp1 APN 1 118462547 missense probably damaging 1.00
IGL03100:Clasp1 APN 1 118467896 missense possibly damaging 0.79
IGL03115:Clasp1 APN 1 118501323 nonsense probably null
IGL03122:Clasp1 APN 1 118510277 missense probably damaging 1.00
IGL03180:Clasp1 APN 1 118505525 missense probably benign 0.33
IGL03248:Clasp1 APN 1 118602476 missense probably benign 0.01
IGL03388:Clasp1 APN 1 118505503 missense possibly damaging 0.95
F5770:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
I2288:Clasp1 UTSW 1 118565229 missense probably benign 0.09
PIT4585001:Clasp1 UTSW 1 118462555 missense probably damaging 0.99
R0079:Clasp1 UTSW 1 118543304 missense probably damaging 1.00
R0395:Clasp1 UTSW 1 118539331 missense possibly damaging 0.48
R0960:Clasp1 UTSW 1 118552026 missense probably benign 0.39
R1448:Clasp1 UTSW 1 118508916 missense probably benign 0.01
R1497:Clasp1 UTSW 1 118552058 missense probably benign 0.42
R1607:Clasp1 UTSW 1 118504959 missense probably damaging 0.98
R1722:Clasp1 UTSW 1 118590464 missense probably damaging 1.00
R1758:Clasp1 UTSW 1 118548025 missense probably damaging 1.00
R1765:Clasp1 UTSW 1 118505531 missense probably damaging 0.99
R1855:Clasp1 UTSW 1 118508894 missense probably damaging 1.00
R1861:Clasp1 UTSW 1 118570931 missense possibly damaging 0.93
R1874:Clasp1 UTSW 1 118600585 critical splice donor site probably null
R1942:Clasp1 UTSW 1 118501348 missense possibly damaging 0.94
R2025:Clasp1 UTSW 1 118504899 missense probably damaging 1.00
R2174:Clasp1 UTSW 1 118560095 missense probably damaging 1.00
R2280:Clasp1 UTSW 1 118565183 missense probably benign 0.05
R2288:Clasp1 UTSW 1 118578878 missense probably benign
R2895:Clasp1 UTSW 1 118459838 missense probably damaging 1.00
R3958:Clasp1 UTSW 1 118467881 missense probably damaging 0.99
R4073:Clasp1 UTSW 1 118503848 missense probably damaging 1.00
R4206:Clasp1 UTSW 1 118578906 missense probably damaging 1.00
R4465:Clasp1 UTSW 1 118561078 missense probably damaging 1.00
R4609:Clasp1 UTSW 1 118503035 intron probably benign
R4679:Clasp1 UTSW 1 118543271 missense probably damaging 0.99
R4707:Clasp1 UTSW 1 118543197 nonsense probably null
R4809:Clasp1 UTSW 1 118461250 missense probably benign 0.00
R4906:Clasp1 UTSW 1 118508910 nonsense probably null
R5048:Clasp1 UTSW 1 118547610 intron probably benign
R5298:Clasp1 UTSW 1 118547920 missense possibly damaging 0.71
R5485:Clasp1 UTSW 1 118467913 missense possibly damaging 0.95
R5516:Clasp1 UTSW 1 118497721 missense probably damaging 1.00
R5911:Clasp1 UTSW 1 118506908 unclassified probably benign
R6092:Clasp1 UTSW 1 118510298 missense probably damaging 0.97
R6181:Clasp1 UTSW 1 118419817 missense probably benign 0.18
R6478:Clasp1 UTSW 1 118512180 nonsense probably null
R7090:Clasp1 UTSW 1 118482086 missense probably benign 0.45
R7216:Clasp1 UTSW 1 118547918 missense probably benign 0.00
R7508:Clasp1 UTSW 1 118545434 missense probably benign 0.30
R7541:Clasp1 UTSW 1 118542997 intron probably null
V7581:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
X0028:Clasp1 UTSW 1 118551125 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCTGCTCTCTTGGAGTTGAC -3'
(R):5'- GGTTTCTCAGCTCTAATGTCAGC -3'

Sequencing Primer
(F):5'- AGTTGACTGTCCAGCAAGC -3'
(R):5'- CTCAGCTCTAATGTCAGCAGTAGG -3'
Posted On2016-12-20