Incidental Mutation 'R5821:Tgm2'
ID 449920
Institutional Source Beutler Lab
Gene Symbol Tgm2
Ensembl Gene ENSMUSG00000037820
Gene Name transglutaminase 2, C polypeptide
Synonyms TG2, TG C, tissue transglutaminase, protein-glutamine gamma-glutamyltransferase, G[a]h, tTGas, TGase2, tTG
MMRRC Submission 043401-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R5821 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 157958325-157988312 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 157984974 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 44 (Y44F)
Ref Sequence ENSEMBL: ENSMUSP00000133662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000174718]
AlphaFold P21981
Predicted Effect probably benign
Transcript: ENSMUST00000103122
AA Change: Y44F

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: Y44F

DomainStartEndE-ValueType
Pfam:Transglut_N 6 122 3.6e-34 PFAM
TGc 269 361 1.11e-38 SMART
Pfam:Transglut_C 473 572 5.7e-29 PFAM
Pfam:Transglut_C 586 685 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152690
Predicted Effect possibly damaging
Transcript: ENSMUST00000174718
AA Change: Y44F

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133662
Gene: ENSMUSG00000037820
AA Change: Y44F

DomainStartEndE-ValueType
Pfam:Transglut_N 5 124 1.9e-37 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,686,458 (GRCm39) V278D possibly damaging Het
Acacb A G 5: 114,322,167 (GRCm39) D227G possibly damaging Het
Akap9 A G 5: 4,096,064 (GRCm39) E2313G probably benign Het
Cchcr1 A T 17: 35,839,745 (GRCm39) E564D probably damaging Het
Cers2 G A 3: 95,229,008 (GRCm39) probably benign Het
Cfap161 A G 7: 83,425,188 (GRCm39) I301T probably benign Het
Ciita A T 16: 10,329,669 (GRCm39) E648V possibly damaging Het
Cir1 C T 2: 73,142,804 (GRCm39) C10Y probably damaging Het
Clasp1 T A 1: 118,518,214 (GRCm39) F1087I probably damaging Het
Cped1 C A 6: 22,138,681 (GRCm39) F415L probably benign Het
Dnah7b A G 1: 46,181,292 (GRCm39) T1060A possibly damaging Het
Epha5 G T 5: 84,232,587 (GRCm39) P809H probably damaging Het
Fuca1 T A 4: 135,650,273 (GRCm39) probably null Het
Galnt2l A T 8: 123,627,372 (GRCm39) *98R probably null Het
Gm26796 G A 12: 80,805,564 (GRCm39) R237C unknown Het
Idua A G 5: 108,827,600 (GRCm39) Y138C probably benign Het
Ighd A T 12: 113,373,253 (GRCm39) L240H probably benign Het
Ing2 C G 8: 48,121,861 (GRCm39) C229S probably benign Het
Kat8 G A 7: 127,523,988 (GRCm39) E343K probably damaging Het
Kctd8 A T 5: 69,267,828 (GRCm39) N427K probably benign Het
Kif16b T C 2: 142,544,586 (GRCm39) E1147G probably damaging Het
Kif18a G A 2: 109,120,190 (GRCm39) probably benign Het
Krt82 T A 15: 101,456,820 (GRCm39) R187* probably null Het
Lrrk2 T C 15: 91,593,593 (GRCm39) probably null Het
M1ap T C 6: 82,945,083 (GRCm39) Y126H probably benign Het
Mmel1 A G 4: 154,970,044 (GRCm39) N226D possibly damaging Het
Mtmr11 A G 3: 96,075,185 (GRCm39) D353G possibly damaging Het
Nfkbia A T 12: 55,538,005 (GRCm39) H149Q probably damaging Het
Nr5a1 A T 2: 38,598,511 (GRCm39) F95L probably damaging Het
Nutm2 A G 13: 50,623,891 (GRCm39) Y196C probably benign Het
Oxtr A G 6: 112,466,457 (GRCm39) I101T probably damaging Het
Pcsk2 T A 2: 143,591,035 (GRCm39) probably null Het
Pde5a T C 3: 122,611,604 (GRCm39) I514T probably benign Het
Pign A G 1: 105,516,788 (GRCm39) W585R possibly damaging Het
Pomgnt1 A G 4: 116,012,933 (GRCm39) S407G probably benign Het
Ppfia3 G A 7: 45,003,040 (GRCm39) T372I probably damaging Het
Prrc2b A T 2: 32,102,144 (GRCm39) E739V probably damaging Het
Ro60 A G 1: 143,642,503 (GRCm39) V209A probably benign Het
Scn7a T C 2: 66,574,047 (GRCm39) E192G probably damaging Het
Slmap T C 14: 26,183,435 (GRCm39) D316G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 (GRCm39) probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 (GRCm39) probably benign Het
Tmc8 C A 11: 117,683,455 (GRCm39) S670* probably null Het
Tmem145 A G 7: 25,014,946 (GRCm39) D523G probably benign Het
Vmn2r115 G A 17: 23,566,937 (GRCm39) G483E probably damaging Het
Other mutations in Tgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Tgm2 APN 2 157,966,051 (GRCm39) missense probably benign
IGL03110:Tgm2 APN 2 157,973,410 (GRCm39) nonsense probably null
IGL03397:Tgm2 APN 2 157,962,178 (GRCm39) missense probably damaging 1.00
R0595:Tgm2 UTSW 2 157,984,962 (GRCm39) missense probably damaging 1.00
R0786:Tgm2 UTSW 2 157,966,301 (GRCm39) missense probably damaging 1.00
R1019:Tgm2 UTSW 2 157,966,074 (GRCm39) nonsense probably null
R1395:Tgm2 UTSW 2 157,966,172 (GRCm39) missense probably benign 0.01
R1732:Tgm2 UTSW 2 157,976,277 (GRCm39) missense probably damaging 1.00
R1776:Tgm2 UTSW 2 157,973,379 (GRCm39) missense probably benign 0.00
R1863:Tgm2 UTSW 2 157,966,139 (GRCm39) missense probably damaging 1.00
R2863:Tgm2 UTSW 2 157,985,019 (GRCm39) missense probably benign 0.01
R3036:Tgm2 UTSW 2 157,966,167 (GRCm39) missense probably benign 0.00
R4200:Tgm2 UTSW 2 157,974,410 (GRCm39) missense probably benign
R4370:Tgm2 UTSW 2 157,966,221 (GRCm39) nonsense probably null
R4612:Tgm2 UTSW 2 157,966,124 (GRCm39) missense probably benign 0.16
R5100:Tgm2 UTSW 2 157,969,084 (GRCm39) missense probably benign 0.33
R5213:Tgm2 UTSW 2 157,984,980 (GRCm39) missense possibly damaging 0.88
R5253:Tgm2 UTSW 2 157,971,358 (GRCm39) missense probably damaging 1.00
R5585:Tgm2 UTSW 2 157,973,375 (GRCm39) nonsense probably null
R5593:Tgm2 UTSW 2 157,969,262 (GRCm39) missense probably damaging 1.00
R5616:Tgm2 UTSW 2 157,970,640 (GRCm39) missense probably damaging 1.00
R5796:Tgm2 UTSW 2 157,960,824 (GRCm39) missense probably benign 0.00
R5842:Tgm2 UTSW 2 157,985,001 (GRCm39) missense probably damaging 1.00
R6317:Tgm2 UTSW 2 157,966,070 (GRCm39) missense probably benign 0.18
R6610:Tgm2 UTSW 2 157,985,020 (GRCm39) nonsense probably null
R7134:Tgm2 UTSW 2 157,980,812 (GRCm39) missense probably benign
R7151:Tgm2 UTSW 2 157,971,315 (GRCm39) missense possibly damaging 0.95
R7268:Tgm2 UTSW 2 157,962,188 (GRCm39) nonsense probably null
R7719:Tgm2 UTSW 2 157,985,038 (GRCm39) missense probably damaging 1.00
R8728:Tgm2 UTSW 2 157,962,065 (GRCm39) missense probably benign 0.02
R9389:Tgm2 UTSW 2 157,959,816 (GRCm39) missense probably benign 0.19
R9460:Tgm2 UTSW 2 157,971,241 (GRCm39) critical splice donor site probably null
R9509:Tgm2 UTSW 2 157,969,210 (GRCm39) nonsense probably null
R9518:Tgm2 UTSW 2 157,985,049 (GRCm39) missense probably benign 0.03
R9781:Tgm2 UTSW 2 157,971,321 (GRCm39) missense probably damaging 1.00
X0058:Tgm2 UTSW 2 157,966,067 (GRCm39) missense probably benign 0.01
X0067:Tgm2 UTSW 2 157,960,765 (GRCm39) critical splice donor site probably null
Z1177:Tgm2 UTSW 2 157,959,819 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTATGGAAAGCAGCGACC -3'
(R):5'- TGAGACCACAGCTTGCTGAG -3'

Sequencing Primer
(F):5'- TACACACAGGCTTGCAGG -3'
(R):5'- CTTGCTGAGGGATGCCACAATG -3'
Posted On 2016-12-20