Incidental Mutation 'R5821:Kctd8'
ID449931
Institutional Source Beutler Lab
Gene Symbol Kctd8
Ensembl Gene ENSMUSG00000037653
Gene Namepotassium channel tetramerisation domain containing 8
Synonyms
MMRRC Submission 043401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5821 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location69109285-69341679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69110485 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 427 (N427K)
Ref Sequence ENSEMBL: ENSMUSP00000055326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054095]
Predicted Effect probably benign
Transcript: ENSMUST00000054095
AA Change: N427K

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055326
Gene: ENSMUSG00000037653
AA Change: N427K

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
BTB 44 154 1.46e-8 SMART
low complexity region 172 204 N/A INTRINSIC
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,446 V278D possibly damaging Het
Acacb A G 5: 114,184,106 D227G possibly damaging Het
Akap9 A G 5: 4,046,064 E2313G probably benign Het
Cchcr1 A T 17: 35,528,848 E564D probably damaging Het
Cers2 G A 3: 95,321,697 probably benign Het
Cfap161 A G 7: 83,775,980 I301T probably benign Het
Ciita A T 16: 10,511,805 E648V possibly damaging Het
Cir1 C T 2: 73,312,460 C10Y probably damaging Het
Clasp1 T A 1: 118,590,484 F1087I probably damaging Het
Cped1 C A 6: 22,138,682 F415L probably benign Het
Dnah7b A G 1: 46,142,132 T1060A possibly damaging Het
Epha5 G T 5: 84,084,728 P809H probably damaging Het
Fuca1 T A 4: 135,922,962 probably null Het
Gm20388 A T 8: 122,900,633 *98R probably null Het
Gm26796 G A 12: 80,758,790 R237C unknown Het
Idua A G 5: 108,679,734 Y138C probably benign Het
Ighd A T 12: 113,409,633 L240H probably benign Het
Ing2 C G 8: 47,668,826 C229S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif16b T C 2: 142,702,666 E1147G probably damaging Het
Kif18a G A 2: 109,289,845 probably benign Het
Krt82 T A 15: 101,548,385 R187* probably null Het
Lrrk2 T C 15: 91,709,390 probably null Het
M1ap T C 6: 82,968,102 Y126H probably benign Het
Mmel1 A G 4: 154,885,587 N226D possibly damaging Het
Mtmr11 A G 3: 96,167,869 D353G possibly damaging Het
Nfkbia A T 12: 55,491,220 H149Q probably damaging Het
Nr5a1 A T 2: 38,708,499 F95L probably damaging Het
Nutm2 A G 13: 50,469,855 Y196C probably benign Het
Oxtr A G 6: 112,489,496 I101T probably damaging Het
Pcsk2 T A 2: 143,749,115 probably null Het
Pde5a T C 3: 122,817,955 I514T probably benign Het
Pign A G 1: 105,589,063 W585R possibly damaging Het
Pomgnt1 A G 4: 116,155,736 S407G probably benign Het
Ppfia3 G A 7: 45,353,616 T372I probably damaging Het
Prrc2b A T 2: 32,212,132 E739V probably damaging Het
Scn7a T C 2: 66,743,703 E192G probably damaging Het
Slmap T C 14: 26,462,280 D316G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tgm2 T A 2: 158,143,054 Y44F possibly damaging Het
Tmc8 C A 11: 117,792,629 S670* probably null Het
Tmem145 A G 7: 25,315,521 D523G probably benign Het
Trove2 A G 1: 143,766,765 V209A probably benign Het
Vmn2r115 G A 17: 23,347,963 G483E probably damaging Het
Other mutations in Kctd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Kctd8 APN 5 69340364 missense possibly damaging 0.90
IGL02212:Kctd8 APN 5 69340688 missense probably benign 0.00
IGL03276:Kctd8 APN 5 69340586 missense possibly damaging 0.71
R0206:Kctd8 UTSW 5 69341165 missense probably damaging 1.00
R0349:Kctd8 UTSW 5 69341010 missense probably damaging 1.00
R1775:Kctd8 UTSW 5 69340560 missense probably damaging 1.00
R1782:Kctd8 UTSW 5 69340976 missense possibly damaging 0.95
R1820:Kctd8 UTSW 5 69340341 missense probably damaging 1.00
R2199:Kctd8 UTSW 5 69341245 missense probably benign 0.02
R2237:Kctd8 UTSW 5 69110409 missense probably damaging 0.98
R2513:Kctd8 UTSW 5 69110645 missense probably benign
R3949:Kctd8 UTSW 5 69341274 missense probably benign 0.20
R4418:Kctd8 UTSW 5 69341162 missense probably damaging 1.00
R4722:Kctd8 UTSW 5 69341201 missense possibly damaging 0.93
R4765:Kctd8 UTSW 5 69340848 missense possibly damaging 0.71
R5009:Kctd8 UTSW 5 69110733 missense probably benign 0.01
R5818:Kctd8 UTSW 5 69296711 missense probably benign
R6857:Kctd8 UTSW 5 69296702 missense probably benign
RF001:Kctd8 UTSW 5 69110432 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTCATCATGACACTCCCAGAG -3'
(R):5'- GCAATGAGCTCTCCACATCC -3'

Sequencing Primer
(F):5'- CTCCCAGAGCATCATCATTATTAC -3'
(R):5'- TGTGACAGCCACTCAGAGG -3'
Posted On2016-12-20