Incidental Mutation 'R5821:Oxtr'
ID449937
Institutional Source Beutler Lab
Gene Symbol Oxtr
Ensembl Gene ENSMUSG00000049112
Gene Nameoxytocin receptor
SynonymsOTR
MMRRC Submission 043401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5821 (G1)
Quality Score215
Status Validated
Chromosome6
Chromosomal Location112473683-112489943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112489496 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 101 (I101T)
Ref Sequence ENSEMBL: ENSMUSP00000051132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053306] [ENSMUST00000204027]
Predicted Effect probably damaging
Transcript: ENSMUST00000053306
AA Change: I101T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051132
Gene: ENSMUSG00000049112
AA Change: I101T

DomainStartEndE-ValueType
Pfam:7tm_4 46 183 2.5e-8 PFAM
Pfam:7TM_GPCR_Srsx 50 339 1.4e-6 PFAM
Pfam:7tm_1 56 328 3.4e-46 PFAM
low complexity region 365 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204027
SMART Domains Protein: ENSMUSP00000145300
Gene: ENSMUSG00000049112

DomainStartEndE-ValueType
SCOP:d1l9ha_ 2 56 2e-6 SMART
Meta Mutation Damage Score 0.8777 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor family and acts as a receptor for oxytocin. Its activity is mediated by G proteins which activate a phosphatidylinositol-calcium second messenger system. The oxytocin-oxytocin receptor system plays an important role in the uterus during parturition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null females fail to lactate and exhibit decreased maternal behavior. Males exhibit an increase in aggression, hypoactivity and vocalization in response to social isolation, and social amnesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,446 V278D possibly damaging Het
Acacb A G 5: 114,184,106 D227G possibly damaging Het
Akap9 A G 5: 4,046,064 E2313G probably benign Het
Cchcr1 A T 17: 35,528,848 E564D probably damaging Het
Cers2 G A 3: 95,321,697 probably benign Het
Cfap161 A G 7: 83,775,980 I301T probably benign Het
Ciita A T 16: 10,511,805 E648V possibly damaging Het
Cir1 C T 2: 73,312,460 C10Y probably damaging Het
Clasp1 T A 1: 118,590,484 F1087I probably damaging Het
Cped1 C A 6: 22,138,682 F415L probably benign Het
Dnah7b A G 1: 46,142,132 T1060A possibly damaging Het
Epha5 G T 5: 84,084,728 P809H probably damaging Het
Fuca1 T A 4: 135,922,962 probably null Het
Gm20388 A T 8: 122,900,633 *98R probably null Het
Gm26796 G A 12: 80,758,790 R237C unknown Het
Idua A G 5: 108,679,734 Y138C probably benign Het
Ighd A T 12: 113,409,633 L240H probably benign Het
Ing2 C G 8: 47,668,826 C229S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kctd8 A T 5: 69,110,485 N427K probably benign Het
Kif16b T C 2: 142,702,666 E1147G probably damaging Het
Kif18a G A 2: 109,289,845 probably benign Het
Krt82 T A 15: 101,548,385 R187* probably null Het
Lrrk2 T C 15: 91,709,390 probably null Het
M1ap T C 6: 82,968,102 Y126H probably benign Het
Mmel1 A G 4: 154,885,587 N226D possibly damaging Het
Mtmr11 A G 3: 96,167,869 D353G possibly damaging Het
Nfkbia A T 12: 55,491,220 H149Q probably damaging Het
Nr5a1 A T 2: 38,708,499 F95L probably damaging Het
Nutm2 A G 13: 50,469,855 Y196C probably benign Het
Pcsk2 T A 2: 143,749,115 probably null Het
Pde5a T C 3: 122,817,955 I514T probably benign Het
Pign A G 1: 105,589,063 W585R possibly damaging Het
Pomgnt1 A G 4: 116,155,736 S407G probably benign Het
Ppfia3 G A 7: 45,353,616 T372I probably damaging Het
Prrc2b A T 2: 32,212,132 E739V probably damaging Het
Scn7a T C 2: 66,743,703 E192G probably damaging Het
Slmap T C 14: 26,462,280 D316G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tgm2 T A 2: 158,143,054 Y44F possibly damaging Het
Tmc8 C A 11: 117,792,629 S670* probably null Het
Tmem145 A G 7: 25,315,521 D523G probably benign Het
Trove2 A G 1: 143,766,765 V209A probably benign Het
Vmn2r115 G A 17: 23,347,963 G483E probably damaging Het
Other mutations in Oxtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02418:Oxtr APN 6 112477239 missense probably damaging 1.00
R0610:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0635:Oxtr UTSW 6 112489200 missense probably damaging 1.00
R0924:Oxtr UTSW 6 112489637 unclassified probably null
R0930:Oxtr UTSW 6 112489637 unclassified probably null
R0959:Oxtr UTSW 6 112477177 missense probably benign 0.08
R0961:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1099:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1101:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1102:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1344:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1401:Oxtr UTSW 6 112477177 missense probably benign 0.08
R1682:Oxtr UTSW 6 112477177 missense probably benign 0.08
R2254:Oxtr UTSW 6 112489106 missense probably damaging 0.98
R3424:Oxtr UTSW 6 112477230 missense probably benign 0.31
R3805:Oxtr UTSW 6 112477186 missense probably benign 0.14
R4598:Oxtr UTSW 6 112489752 missense probably benign 0.20
R5757:Oxtr UTSW 6 112477261 missense probably damaging 1.00
R6667:Oxtr UTSW 6 112477099 unclassified probably benign
Z1176:Oxtr UTSW 6 112489695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGAGAAAATGTGCACCTG -3'
(R):5'- CGGTCCTGTGTCTCATACTG -3'

Sequencing Primer
(F):5'- AAATGTGCACCTGCGGCAC -3'
(R):5'- CATACTGTTCCTGGCTCTGAGTG -3'
Posted On2016-12-20