Incidental Mutation 'R0548:Mylk'
ID 44994
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission 038740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0548 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 34879475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 403 (E403Q)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000023538
AA Change: E403Q

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: E403Q

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155268
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T G 8: 40,826,467 C632G probably damaging Het
Adamtsl3 T C 7: 82,528,983 probably null Het
Agfg1 A G 1: 82,886,431 T447A probably damaging Het
Ankrd37 C T 8: 45,998,396 probably null Het
Apob A T 12: 8,006,282 D1555V probably damaging Het
Asxl3 T A 18: 22,521,792 probably benign Het
Brca2 C A 5: 150,544,935 D2242E probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Cdk5rap2 A T 4: 70,349,142 probably null Het
Cox10 A T 11: 63,976,352 Y273N probably damaging Het
Dcbld2 A T 16: 58,455,145 D408V probably damaging Het
Enam A T 5: 88,503,105 E824D probably damaging Het
Epm2aip1 T C 9: 111,273,341 Y461H probably damaging Het
Fam72a T A 1: 131,533,861 S95T probably damaging Het
Fiz1 A T 7: 5,009,168 V117D possibly damaging Het
Gm10355 C T 3: 101,307,060 noncoding transcript Het
Gm11595 A T 11: 99,772,141 C238S unknown Het
Gm7589 T G 9: 59,146,156 noncoding transcript Het
H6pd A T 4: 149,981,616 V771E probably damaging Het
Htt T C 5: 34,870,746 L1782P probably damaging Het
Il33 T C 19: 29,954,647 S147P probably benign Het
Lct T C 1: 128,285,195 Y1907C probably damaging Het
Lrp2 G A 2: 69,537,638 probably benign Het
Map1b T C 13: 99,431,683 K1510R unknown Het
Marco T C 1: 120,492,038 T187A probably benign Het
Mki67 T A 7: 135,695,256 K2683M probably damaging Het
Mki67 A T 7: 135,696,908 N2132K possibly damaging Het
Mmp15 T C 8: 95,372,351 V602A probably damaging Het
Mphosph10 T A 7: 64,378,800 M536L probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
N4bp2 G T 5: 65,808,153 V1182L probably benign Het
Nlrc5 C A 8: 94,521,783 F1715L probably null Het
Nsd2 T A 5: 33,893,538 V1253E probably damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1225 C A 2: 89,170,648 C188F probably damaging Het
Olfr1537 A T 9: 39,238,371 S18T probably benign Het
Olfr437 T A 6: 43,167,187 I43K probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pi4ka A T 16: 17,307,718 N4K possibly damaging Het
Plxna4 A T 6: 32,158,015 I1751N probably damaging Het
Postn C A 3: 54,367,576 S122* probably null Het
Ppp4r4 A T 12: 103,612,815 R762* probably null Het
Rrm1 G T 7: 102,467,067 probably null Het
Rrp15 A G 1: 186,736,234 V195A probably benign Het
Rtl1 T A 12: 109,591,655 D1250V probably damaging Het
Rxrg T C 1: 167,631,219 probably benign Het
Scn10a T C 9: 119,665,928 K416E probably benign Het
Serping1 T C 2: 84,770,081 probably benign Het
Slc12a6 T C 2: 112,335,924 probably null Het
Smo A T 6: 29,759,586 Q639L possibly damaging Het
Synrg T C 11: 83,982,188 probably benign Het
Tars2 T C 3: 95,742,659 D470G probably damaging Het
Tln1 T C 4: 43,542,709 N1399S possibly damaging Het
Tmem131 A G 1: 36,838,038 V240A probably damaging Het
Tmem232 G A 17: 65,382,620 T500I probably benign Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Toporsl G A 4: 52,612,140 V678M possibly damaging Het
Vmn1r7 A T 6: 57,025,081 F65I probably damaging Het
Wdfy4 C T 14: 33,042,621 M2257I probably benign Het
Wdr20rt T A 12: 65,227,315 D344E probably benign Het
Xirp2 C T 2: 67,514,414 A2333V probably benign Het
Zfyve16 T C 13: 92,494,944 K1381R probably benign Het
Zscan18 G T 7: 12,774,176 P466T probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGTGTGAGGATGCTCCCAGAAAGG -3'
(R):5'- TGCATACATACGGGAGGTGCAGAC -3'

Sequencing Primer
(F):5'- AAAGGTCCCGCAGTCCTC -3'
(R):5'- GGAGGTGCAGACTGGTG -3'
Posted On 2013-06-11