Incidental Mutation 'R5821:Slmap'
ID449950
Institutional Source Beutler Lab
Gene Symbol Slmap
Ensembl Gene ENSMUSG00000021870
Gene Namesarcolemma associated protein
SynonymsD330001L02Rik, Slap
MMRRC Submission 043401-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5821 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location26413168-26534931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26462280 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 316 (D316G)
Ref Sequence ENSEMBL: ENSMUSP00000117816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]
Predicted Effect probably damaging
Transcript: ENSMUST00000038522
AA Change: D316G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870
AA Change: D316G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090359
AA Change: D316G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870
AA Change: D316G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 490 572 N/A INTRINSIC
coiled coil region 599 799 N/A INTRINSIC
transmembrane domain 801 823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102956
AA Change: D316G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870
AA Change: D316G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112330
AA Change: D316G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870
AA Change: D316G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 383 N/A INTRINSIC
coiled coil region 452 534 N/A INTRINSIC
coiled coil region 561 761 N/A INTRINSIC
transmembrane domain 763 785 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112331
AA Change: D195G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870
AA Change: D195G

DomainStartEndE-ValueType
coiled coil region 46 78 N/A INTRINSIC
coiled coil region 109 260 N/A INTRINSIC
coiled coil region 352 434 N/A INTRINSIC
coiled coil region 461 661 N/A INTRINSIC
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139075
AA Change: D316G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870
AA Change: D316G

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 507 589 N/A INTRINSIC
coiled coil region 616 816 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142679
SMART Domains Protein: ENSMUSP00000123072
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 52 N/A INTRINSIC
coiled coil region 97 179 N/A INTRINSIC
coiled coil region 206 405 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144737
Predicted Effect probably benign
Transcript: ENSMUST00000145738
SMART Domains Protein: ENSMUSP00000117276
Gene: ENSMUSG00000021870

DomainStartEndE-ValueType
coiled coil region 1 59 N/A INTRINSIC
coiled coil region 138 220 N/A INTRINSIC
coiled coil region 247 447 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146438
AA Change: D79G
SMART Domains Protein: ENSMUSP00000123344
Gene: ENSMUSG00000021870
AA Change: D79G

DomainStartEndE-ValueType
coiled coil region 17 142 N/A INTRINSIC
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,446 V278D possibly damaging Het
Acacb A G 5: 114,184,106 D227G possibly damaging Het
Akap9 A G 5: 4,046,064 E2313G probably benign Het
Cchcr1 A T 17: 35,528,848 E564D probably damaging Het
Cers2 G A 3: 95,321,697 probably benign Het
Cfap161 A G 7: 83,775,980 I301T probably benign Het
Ciita A T 16: 10,511,805 E648V possibly damaging Het
Cir1 C T 2: 73,312,460 C10Y probably damaging Het
Clasp1 T A 1: 118,590,484 F1087I probably damaging Het
Cped1 C A 6: 22,138,682 F415L probably benign Het
Dnah7b A G 1: 46,142,132 T1060A possibly damaging Het
Epha5 G T 5: 84,084,728 P809H probably damaging Het
Fuca1 T A 4: 135,922,962 probably null Het
Gm20388 A T 8: 122,900,633 *98R probably null Het
Gm26796 G A 12: 80,758,790 R237C unknown Het
Idua A G 5: 108,679,734 Y138C probably benign Het
Ighd A T 12: 113,409,633 L240H probably benign Het
Ing2 C G 8: 47,668,826 C229S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kctd8 A T 5: 69,110,485 N427K probably benign Het
Kif16b T C 2: 142,702,666 E1147G probably damaging Het
Kif18a G A 2: 109,289,845 probably benign Het
Krt82 T A 15: 101,548,385 R187* probably null Het
Lrrk2 T C 15: 91,709,390 probably null Het
M1ap T C 6: 82,968,102 Y126H probably benign Het
Mmel1 A G 4: 154,885,587 N226D possibly damaging Het
Mtmr11 A G 3: 96,167,869 D353G possibly damaging Het
Nfkbia A T 12: 55,491,220 H149Q probably damaging Het
Nr5a1 A T 2: 38,708,499 F95L probably damaging Het
Nutm2 A G 13: 50,469,855 Y196C probably benign Het
Oxtr A G 6: 112,489,496 I101T probably damaging Het
Pcsk2 T A 2: 143,749,115 probably null Het
Pde5a T C 3: 122,817,955 I514T probably benign Het
Pign A G 1: 105,589,063 W585R possibly damaging Het
Pomgnt1 A G 4: 116,155,736 S407G probably benign Het
Ppfia3 G A 7: 45,353,616 T372I probably damaging Het
Prrc2b A T 2: 32,212,132 E739V probably damaging Het
Scn7a T C 2: 66,743,703 E192G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tgm2 T A 2: 158,143,054 Y44F possibly damaging Het
Tmc8 C A 11: 117,792,629 S670* probably null Het
Tmem145 A G 7: 25,315,521 D523G probably benign Het
Trove2 A G 1: 143,766,765 V209A probably benign Het
Vmn2r115 G A 17: 23,347,963 G483E probably damaging Het
Other mutations in Slmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Slmap APN 14 26463710 missense probably damaging 0.97
IGL02612:Slmap APN 14 26459466 splice site probably benign
IGL02630:Slmap APN 14 26422431 missense possibly damaging 0.93
IGL02798:Slmap APN 14 26470378 missense possibly damaging 0.88
PIT4382001:Slmap UTSW 14 26533431 missense probably damaging 1.00
R0433:Slmap UTSW 14 26453594 nonsense probably null
R0963:Slmap UTSW 14 26468520 missense probably damaging 1.00
R1721:Slmap UTSW 14 26460218 splice site probably benign
R1848:Slmap UTSW 14 26422574 missense probably benign
R2151:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2152:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2153:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2154:Slmap UTSW 14 26418247 missense probably damaging 1.00
R3725:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3726:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3935:Slmap UTSW 14 26459415 missense probably benign
R4118:Slmap UTSW 14 26482872 missense probably damaging 0.99
R4594:Slmap UTSW 14 26465617 missense probably damaging 1.00
R4731:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4732:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4733:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4817:Slmap UTSW 14 26462352 missense probably damaging 0.97
R4847:Slmap UTSW 14 26426608 missense possibly damaging 0.90
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R5092:Slmap UTSW 14 26463589 missense probably damaging 1.00
R5211:Slmap UTSW 14 26482962 missense probably damaging 1.00
R5387:Slmap UTSW 14 26459933 missense probably benign 0.22
R6404:Slmap UTSW 14 26422411 splice site probably null
R6856:Slmap UTSW 14 26430092 intron probably null
R6977:Slmap UTSW 14 26533419 missense probably damaging 1.00
R7108:Slmap UTSW 14 26422521 missense probably benign 0.04
R7320:Slmap UTSW 14 26460072 missense possibly damaging 0.53
R7470:Slmap UTSW 14 26427420 missense probably benign
R7520:Slmap UTSW 14 26427420 missense probably benign
R7540:Slmap UTSW 14 26460191 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429846 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429848 missense probably damaging 0.99
Z1177:Slmap UTSW 14 26533450 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGTCTAGTGGTTGACATAGAAG -3'
(R):5'- TTGATGTAGACTAGTTCAGAACTACAC -3'

Sequencing Primer
(F):5'- GGCTGGATTAAGAATGTCCCTCAC -3'
(R):5'- GAAGATGAATGTACCCACC -3'
Posted On2016-12-20