Mutagenetix > Incidental Mutations

Incidental Mutation 'R5821:Krt82'

449953

Institutional Source

Beutler Lab

Gene Symbol

Krt82

Ensembl Gene

ENSMUSG00000049548

Gene Name

keratin 82

Synonyms

Krt2-20

MMRRC Submission

043401-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R5821 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101541214-101550667 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 101548385 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 187 (R187*)

Ref Sequence

ENSEMBL: ENSMUSP00000023713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023713] [ENSMUST00000023714]

Predicted Effect

probably null
Transcript: ENSMUST00000023713
AA Change: R187*

SMART Domains

Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: R187*

Domain	Start	End	E-Value	Type
low complexity region	38	57	N/A	INTRINSIC
Pfam:Keratin_2_head	61	114	6.1e-13	PFAM
Filament	117	428	1.32e-153	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000023714

SMART Domains

Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	139	3.1e-24	PFAM
Filament	142	453	1.05e-179	SMART
low complexity region	465	522	N/A	INTRINSIC
low complexity region	527	535	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	A	T	2: 30,796,446	V278D	possibly damaging	Het
Acacb	A	G	5: 114,184,106	D227G	possibly damaging	Het
Akap9	A	G	5: 4,046,064	E2313G	probably benign	Het
Cchcr1	A	T	17: 35,528,848	E564D	probably damaging	Het
Cers2	G	A	3: 95,321,697		probably benign	Het
Cfap161	A	G	7: 83,775,980	I301T	probably benign	Het
Ciita	A	T	16: 10,511,805	E648V	possibly damaging	Het
Cir1	C	T	2: 73,312,460	C10Y	probably damaging	Het
Clasp1	T	A	1: 118,590,484	F1087I	probably damaging	Het
Cped1	C	A	6: 22,138,682	F415L	probably benign	Het
Dnah7b	A	G	1: 46,142,132	T1060A	possibly damaging	Het
Epha5	G	T	5: 84,084,728	P809H	probably damaging	Het
Fuca1	T	A	4: 135,922,962		probably null	Het
Gm20388	A	T	8: 122,900,633	*98R	probably null	Het
Gm26796	G	A	12: 80,758,790	R237C	unknown	Het
Idua	A	G	5: 108,679,734	Y138C	probably benign	Het
Ighd	A	T	12: 113,409,633	L240H	probably benign	Het
Ing2	C	G	8: 47,668,826	C229S	probably benign	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Kctd8	A	T	5: 69,110,485	N427K	probably benign	Het
Kif16b	T	C	2: 142,702,666	E1147G	probably damaging	Het
Kif18a	G	A	2: 109,289,845		probably benign	Het
Lrrk2	T	C	15: 91,709,390		probably null	Het
M1ap	T	C	6: 82,968,102	Y126H	probably benign	Het
Mmel1	A	G	4: 154,885,587	N226D	possibly damaging	Het
Mtmr11	A	G	3: 96,167,869	D353G	possibly damaging	Het
Nfkbia	A	T	12: 55,491,220	H149Q	probably damaging	Het
Nr5a1	A	T	2: 38,708,499	F95L	probably damaging	Het
Nutm2	A	G	13: 50,469,855	Y196C	probably benign	Het
Oxtr	A	G	6: 112,489,496	I101T	probably damaging	Het
Pcsk2	T	A	2: 143,749,115		probably null	Het
Pde5a	T	C	3: 122,817,955	I514T	probably benign	Het
Pign	A	G	1: 105,589,063	W585R	possibly damaging	Het
Pomgnt1	A	G	4: 116,155,736	S407G	probably benign	Het
Ppfia3	G	A	7: 45,353,616	T372I	probably damaging	Het
Prrc2b	A	T	2: 32,212,132	E739V	probably damaging	Het
Scn7a	T	C	2: 66,743,703	E192G	probably damaging	Het
Slmap	T	C	14: 26,462,280	D316G	probably damaging	Het
Smim8	GGTTTAATGAAGAG	GG	4: 34,771,259		probably benign	Het
Smim8	TTTAATGAAGAGCT	TT	4: 34,771,261		probably benign	Het
Tgm2	T	A	2: 158,143,054	Y44F	possibly damaging	Het
Tmc8	C	A	11: 117,792,629	S670*	probably null	Het
Tmem145	A	G	7: 25,315,521	D523G	probably benign	Het
Trove2	A	G	1: 143,766,765	V209A	probably benign	Het
Vmn2r115	G	A	17: 23,347,963	G483E	probably damaging	Het

Other mutations in Krt82

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Krt82	APN	15	101543378	missense	probably damaging	0.97
IGL01112:Krt82	APN	15	101545523	missense	probably damaging	1.00
IGL01820:Krt82	APN	15	101543452	splice site	probably benign
IGL02529:Krt82	APN	15	101550396	nonsense	probably null
IGL02894:Krt82	APN	15	101542720	missense	probably damaging	1.00
IGL02974:Krt82	APN	15	101550585	nonsense	probably null
IGL03263:Krt82	APN	15	101541872	missense	probably benign	0.00
R0268:Krt82	UTSW	15	101541713	missense	probably benign	0.02
R0385:Krt82	UTSW	15	101545593	missense	probably damaging	1.00
R0542:Krt82	UTSW	15	101545600	splice site	probably benign
R1073:Krt82	UTSW	15	101550254	missense	probably damaging	1.00
R1601:Krt82	UTSW	15	101545153	missense	probably damaging	1.00
R1795:Krt82	UTSW	15	101543384	missense	possibly damaging	0.90
R1944:Krt82	UTSW	15	101548535	missense	probably damaging	1.00
R1974:Krt82	UTSW	15	101545162	missense	probably benign	0.00
R2049:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2140:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2851:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2852:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2853:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R3815:Krt82	UTSW	15	101550600	missense	probably damaging	1.00
R4324:Krt82	UTSW	15	101541747	missense	probably benign	0.00
R4798:Krt82	UTSW	15	101550488	missense	probably benign	0.01
R4980:Krt82	UTSW	15	101545099	missense	possibly damaging	0.85
R5212:Krt82	UTSW	15	101545049	missense	probably damaging	1.00
R5260:Krt82	UTSW	15	101548388	missense	possibly damaging	0.88
R6009:Krt82	UTSW	15	101545105	missense	probably benign	0.00
R6955:Krt82	UTSW	15	101542849	missense	probably damaging	1.00
R7194:Krt82	UTSW	15	101542756	missense	probably damaging	1.00
R7307:Krt82	UTSW	15	101542907	missense	probably damaging	0.97
R7420:Krt82	UTSW	15	101545587	missense	probably damaging	0.96
R7837:Krt82	UTSW	15	101548357	missense	possibly damaging	0.86
R8354:Krt82	UTSW	15	101541803	missense	probably damaging	1.00
R8371:Krt82	UTSW	15	101545111	missense	probably benign	0.12
R8454:Krt82	UTSW	15	101541803	missense	probably damaging	1.00
Z1176:Krt82	UTSW	15	101541852	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCCTGCACTACTCAGTTG -3'
(R):5'- TACATCCCTCTGGGTGTTAGTC -3'

Sequencing Primer
(F):5'- GCACTACTCAGTTGTTTTCGTG -3'
(R):5'- TCTGCAGAGACCTGGCGATG -3'

Posted On

2016-12-20