Incidental Mutation 'R5821:Krt82'
ID449953
Institutional Source Beutler Lab
Gene Symbol Krt82
Ensembl Gene ENSMUSG00000049548
Gene Namekeratin 82
SynonymsKrt2-20
MMRRC Submission 043401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5821 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101541214-101550667 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 101548385 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 187 (R187*)
Ref Sequence ENSEMBL: ENSMUSP00000023713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023713] [ENSMUST00000023714]
Predicted Effect probably null
Transcript: ENSMUST00000023713
AA Change: R187*
SMART Domains Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: R187*

DomainStartEndE-ValueType
low complexity region 38 57 N/A INTRINSIC
Pfam:Keratin_2_head 61 114 6.1e-13 PFAM
Filament 117 428 1.32e-153 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023714
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,446 V278D possibly damaging Het
Acacb A G 5: 114,184,106 D227G possibly damaging Het
Akap9 A G 5: 4,046,064 E2313G probably benign Het
Cchcr1 A T 17: 35,528,848 E564D probably damaging Het
Cers2 G A 3: 95,321,697 probably benign Het
Cfap161 A G 7: 83,775,980 I301T probably benign Het
Ciita A T 16: 10,511,805 E648V possibly damaging Het
Cir1 C T 2: 73,312,460 C10Y probably damaging Het
Clasp1 T A 1: 118,590,484 F1087I probably damaging Het
Cped1 C A 6: 22,138,682 F415L probably benign Het
Dnah7b A G 1: 46,142,132 T1060A possibly damaging Het
Epha5 G T 5: 84,084,728 P809H probably damaging Het
Fuca1 T A 4: 135,922,962 probably null Het
Gm20388 A T 8: 122,900,633 *98R probably null Het
Gm26796 G A 12: 80,758,790 R237C unknown Het
Idua A G 5: 108,679,734 Y138C probably benign Het
Ighd A T 12: 113,409,633 L240H probably benign Het
Ing2 C G 8: 47,668,826 C229S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kctd8 A T 5: 69,110,485 N427K probably benign Het
Kif16b T C 2: 142,702,666 E1147G probably damaging Het
Kif18a G A 2: 109,289,845 probably benign Het
Lrrk2 T C 15: 91,709,390 probably null Het
M1ap T C 6: 82,968,102 Y126H probably benign Het
Mmel1 A G 4: 154,885,587 N226D possibly damaging Het
Mtmr11 A G 3: 96,167,869 D353G possibly damaging Het
Nfkbia A T 12: 55,491,220 H149Q probably damaging Het
Nr5a1 A T 2: 38,708,499 F95L probably damaging Het
Nutm2 A G 13: 50,469,855 Y196C probably benign Het
Oxtr A G 6: 112,489,496 I101T probably damaging Het
Pcsk2 T A 2: 143,749,115 probably null Het
Pde5a T C 3: 122,817,955 I514T probably benign Het
Pign A G 1: 105,589,063 W585R possibly damaging Het
Pomgnt1 A G 4: 116,155,736 S407G probably benign Het
Ppfia3 G A 7: 45,353,616 T372I probably damaging Het
Prrc2b A T 2: 32,212,132 E739V probably damaging Het
Scn7a T C 2: 66,743,703 E192G probably damaging Het
Slmap T C 14: 26,462,280 D316G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tgm2 T A 2: 158,143,054 Y44F possibly damaging Het
Tmc8 C A 11: 117,792,629 S670* probably null Het
Tmem145 A G 7: 25,315,521 D523G probably benign Het
Trove2 A G 1: 143,766,765 V209A probably benign Het
Vmn2r115 G A 17: 23,347,963 G483E probably damaging Het
Other mutations in Krt82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Krt82 APN 15 101543378 missense probably damaging 0.97
IGL01112:Krt82 APN 15 101545523 missense probably damaging 1.00
IGL01820:Krt82 APN 15 101543452 splice site probably benign
IGL02529:Krt82 APN 15 101550396 nonsense probably null
IGL02894:Krt82 APN 15 101542720 missense probably damaging 1.00
IGL02974:Krt82 APN 15 101550585 nonsense probably null
IGL03263:Krt82 APN 15 101541872 missense probably benign 0.00
R0268:Krt82 UTSW 15 101541713 missense probably benign 0.02
R0385:Krt82 UTSW 15 101545593 missense probably damaging 1.00
R0542:Krt82 UTSW 15 101545600 splice site probably benign
R1073:Krt82 UTSW 15 101550254 missense probably damaging 1.00
R1601:Krt82 UTSW 15 101545153 missense probably damaging 1.00
R1795:Krt82 UTSW 15 101543384 missense possibly damaging 0.90
R1944:Krt82 UTSW 15 101548535 missense probably damaging 1.00
R1974:Krt82 UTSW 15 101545162 missense probably benign 0.00
R2049:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2140:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2851:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2852:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2853:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R3815:Krt82 UTSW 15 101550600 missense probably damaging 1.00
R4324:Krt82 UTSW 15 101541747 missense probably benign 0.00
R4798:Krt82 UTSW 15 101550488 missense probably benign 0.01
R4980:Krt82 UTSW 15 101545099 missense possibly damaging 0.85
R5212:Krt82 UTSW 15 101545049 missense probably damaging 1.00
R5260:Krt82 UTSW 15 101548388 missense possibly damaging 0.88
R6009:Krt82 UTSW 15 101545105 missense probably benign 0.00
R6955:Krt82 UTSW 15 101542849 missense probably damaging 1.00
R7194:Krt82 UTSW 15 101542756 missense probably damaging 1.00
R7307:Krt82 UTSW 15 101542907 missense probably damaging 0.97
R7420:Krt82 UTSW 15 101545587 missense probably damaging 0.96
R7837:Krt82 UTSW 15 101548357 missense possibly damaging 0.86
R8354:Krt82 UTSW 15 101541803 missense probably damaging 1.00
R8371:Krt82 UTSW 15 101545111 missense probably benign 0.12
R8454:Krt82 UTSW 15 101541803 missense probably damaging 1.00
Z1176:Krt82 UTSW 15 101541852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCTGCACTACTCAGTTG -3'
(R):5'- TACATCCCTCTGGGTGTTAGTC -3'

Sequencing Primer
(F):5'- GCACTACTCAGTTGTTTTCGTG -3'
(R):5'- TCTGCAGAGACCTGGCGATG -3'
Posted On2016-12-20