Incidental Mutation 'R5821:Ciita'
ID449954
Institutional Source Beutler Lab
Gene Symbol Ciita
Ensembl Gene ENSMUSG00000022504
Gene Nameclass II transactivator
SynonymsC2ta, Gm9475
MMRRC Submission 043401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5821 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location10480059-10528418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10511805 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 648 (E648V)
Ref Sequence ENSEMBL: ENSMUSP00000154946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023147] [ENSMUST00000184863] [ENSMUST00000230146] [ENSMUST00000230395] [ENSMUST00000230450]
Predicted Effect probably benign
Transcript: ENSMUST00000023147
AA Change: E651V

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023147
Gene: ENSMUSG00000022504
AA Change: E651V

DomainStartEndE-ValueType
low complexity region 216 230 N/A INTRINSIC
Pfam:NACHT 362 533 1.8e-44 PFAM
low complexity region 847 861 N/A INTRINSIC
LRR 931 961 8.53e0 SMART
LRR 962 989 7.37e-4 SMART
LRR 991 1018 1.25e-6 SMART
LRR 1019 1046 2.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184863
SMART Domains Protein: ENSMUSP00000139108
Gene: ENSMUSG00000038055

DomainStartEndE-ValueType
Pfam:Dexa_ind 1 95 4.6e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229906
Predicted Effect possibly damaging
Transcript: ENSMUST00000230146
AA Change: E648V

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230395
AA Change: E728V

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230450
AA Change: E627V

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230533
Meta Mutation Damage Score 0.1382 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the NOD-like receptor protein family. This protein acts as a transcriptional coactivator and component of the enhanceosome complex to stimulate transcription of MHC class II genes in the adaptive immune response. This protein may also regulate the transcription of MHC class I genes. Mutations in the human gene have been linked to a rare immunodeficiency, bare lymphocyte syndrome, and homozygous knockout mice exhibit many features of this disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are immunologically abnormal with extremely little MHC class II expression, greatly reduced serum IgG, and impaired T-dependent antigen responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,446 V278D possibly damaging Het
Acacb A G 5: 114,184,106 D227G possibly damaging Het
Akap9 A G 5: 4,046,064 E2313G probably benign Het
Cchcr1 A T 17: 35,528,848 E564D probably damaging Het
Cers2 G A 3: 95,321,697 probably benign Het
Cfap161 A G 7: 83,775,980 I301T probably benign Het
Cir1 C T 2: 73,312,460 C10Y probably damaging Het
Clasp1 T A 1: 118,590,484 F1087I probably damaging Het
Cped1 C A 6: 22,138,682 F415L probably benign Het
Dnah7b A G 1: 46,142,132 T1060A possibly damaging Het
Epha5 G T 5: 84,084,728 P809H probably damaging Het
Fuca1 T A 4: 135,922,962 probably null Het
Gm20388 A T 8: 122,900,633 *98R probably null Het
Gm26796 G A 12: 80,758,790 R237C unknown Het
Idua A G 5: 108,679,734 Y138C probably benign Het
Ighd A T 12: 113,409,633 L240H probably benign Het
Ing2 C G 8: 47,668,826 C229S probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kctd8 A T 5: 69,110,485 N427K probably benign Het
Kif16b T C 2: 142,702,666 E1147G probably damaging Het
Kif18a G A 2: 109,289,845 probably benign Het
Krt82 T A 15: 101,548,385 R187* probably null Het
Lrrk2 T C 15: 91,709,390 probably null Het
M1ap T C 6: 82,968,102 Y126H probably benign Het
Mmel1 A G 4: 154,885,587 N226D possibly damaging Het
Mtmr11 A G 3: 96,167,869 D353G possibly damaging Het
Nfkbia A T 12: 55,491,220 H149Q probably damaging Het
Nr5a1 A T 2: 38,708,499 F95L probably damaging Het
Nutm2 A G 13: 50,469,855 Y196C probably benign Het
Oxtr A G 6: 112,489,496 I101T probably damaging Het
Pcsk2 T A 2: 143,749,115 probably null Het
Pde5a T C 3: 122,817,955 I514T probably benign Het
Pign A G 1: 105,589,063 W585R possibly damaging Het
Pomgnt1 A G 4: 116,155,736 S407G probably benign Het
Ppfia3 G A 7: 45,353,616 T372I probably damaging Het
Prrc2b A T 2: 32,212,132 E739V probably damaging Het
Scn7a T C 2: 66,743,703 E192G probably damaging Het
Slmap T C 14: 26,462,280 D316G probably damaging Het
Smim8 GGTTTAATGAAGAG GG 4: 34,771,259 probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
Tgm2 T A 2: 158,143,054 Y44F possibly damaging Het
Tmc8 C A 11: 117,792,629 S670* probably null Het
Tmem145 A G 7: 25,315,521 D523G probably benign Het
Trove2 A G 1: 143,766,765 V209A probably benign Het
Vmn2r115 G A 17: 23,347,963 G483E probably damaging Het
Other mutations in Ciita
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Ciita APN 16 10510727 missense probably damaging 0.99
IGL01830:Ciita APN 16 10521051 missense probably damaging 1.00
IGL02557:Ciita APN 16 10512015 missense probably damaging 1.00
IGL02634:Ciita APN 16 10508713 missense probably damaging 1.00
IGL03057:Ciita APN 16 10520959 splice site probably benign
IGL03403:Ciita APN 16 10503872 missense probably damaging 1.00
deshabille UTSW 16 10509207 intron probably null
sisal UTSW 16 10513288 critical splice donor site probably null
R0001:Ciita UTSW 16 10514433 splice site probably benign
R0138:Ciita UTSW 16 10512270 missense probably damaging 1.00
R0583:Ciita UTSW 16 10523804 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R2017:Ciita UTSW 16 10511676 missense probably damaging 1.00
R2072:Ciita UTSW 16 10518353 missense probably benign 0.16
R2410:Ciita UTSW 16 10510704 missense probably damaging 0.99
R4779:Ciita UTSW 16 10511366 missense probably damaging 1.00
R5151:Ciita UTSW 16 10523730 missense probably damaging 1.00
R5233:Ciita UTSW 16 10509401 missense possibly damaging 0.95
R5363:Ciita UTSW 16 10512167 missense probably damaging 1.00
R5431:Ciita UTSW 16 10523792 missense probably damaging 1.00
R6085:Ciita UTSW 16 10512165 missense probably benign 0.08
R6088:Ciita UTSW 16 10511931 missense probably damaging 1.00
R6241:Ciita UTSW 16 10511903 missense probably damaging 1.00
R6354:Ciita UTSW 16 10523746 missense probably damaging 1.00
R6502:Ciita UTSW 16 10511910 missense probably damaging 1.00
R6553:Ciita UTSW 16 10511745 missense probably benign 0.00
R6585:Ciita UTSW 16 10511745 missense probably benign 0.00
R6916:Ciita UTSW 16 10509207 intron probably null
R6937:Ciita UTSW 16 10512491 intron probably null
R7007:Ciita UTSW 16 10511307 missense probably damaging 1.00
R7219:Ciita UTSW 16 10512257 missense probably benign 0.00
R7326:Ciita UTSW 16 10512288 missense probably damaging 1.00
RF019:Ciita UTSW 16 10506747 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTACCTTGTACACTTACAGG -3'
(R):5'- CTCGAGGCTGGAAAACTAATCC -3'

Sequencing Primer
(F):5'- GACTCTATGTCAGCCTGCTAGG -3'
(R):5'- TCCAGCCAGAAAGCGTGGTAC -3'
Posted On2016-12-20