Incidental Mutation 'R5822:Crp'
ID449962
Institutional Source Beutler Lab
Gene Symbol Crp
Ensembl Gene ENSMUSG00000037942
Gene NameC-reactive protein, pentraxin-related
Synonyms
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5822 (G1)
Quality Score175
Status Validated
Chromosome1
Chromosomal Location172698055-172833031 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to C at 172698068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038495]
Predicted Effect probably benign
Transcript: ENSMUST00000038495
SMART Domains Protein: ENSMUSP00000044665
Gene: ENSMUSG00000037942

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PTX 20 225 4.55e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194251
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the pentaxin family. It is involved in several host defense related functions based on its ability to recognize foreign pathogens and damaged cells of the host and to initiate their elimination by interacting with humoral and cellular effector systems in the blood. Consequently, the level of this protein in plasma increases greatly during acute phase response to tissue injury, infection, or other inflammatory stimuli. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele lack detectable C-reactive protein in the serum but are otherwise healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Crp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Crp APN 1 172699001 missense probably benign 0.19
R0920:Crp UTSW 1 172698522 missense probably damaging 1.00
R1871:Crp UTSW 1 172698605 missense possibly damaging 0.79
R4543:Crp UTSW 1 172698737 missense probably benign
R4648:Crp UTSW 1 172698137 start codon destroyed probably null 0.24
R5213:Crp UTSW 1 172698519 missense probably benign 0.00
R5407:Crp UTSW 1 172698109 start gained probably null
Predicted Primers PCR Primer
(F):5'- ACAGAAGCTGGTGATTCAGG -3'
(R):5'- GTTCCGACCATTCTCCCATAGG -3'

Sequencing Primer
(F):5'- AAGCTGGTGATTCAGGGGTCAC -3'
(R):5'- GGGAAAAGATCTTTATGATAGCTCC -3'
Posted On2016-12-20