Incidental Mutation 'R5822:Ppp6c'
ID449963
Institutional Source Beutler Lab
Gene Symbol Ppp6c
Ensembl Gene ENSMUSG00000026753
Gene Nameprotein phosphatase 6, catalytic subunit
Synonyms
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location39194354-39226451 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 39200052 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 81 (Q81*)
Ref Sequence ENSEMBL: ENSMUSP00000145064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028087] [ENSMUST00000204257] [ENSMUST00000204368] [ENSMUST00000204701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028087
AA Change: T150I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028087
Gene: ENSMUSG00000026753
AA Change: T150I

DomainStartEndE-ValueType
PP2Ac 19 289 3.36e-144 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143733
Predicted Effect probably null
Transcript: ENSMUST00000204257
AA Change: Q81*
SMART Domains Protein: ENSMUSP00000145064
Gene: ENSMUSG00000026753
AA Change: Q81*

DomainStartEndE-ValueType
PDB:4IYP|C 1 75 3e-14 PDB
SCOP:d1auia_ 5 57 5e-16 SMART
Blast:PP2Ac 19 74 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000204368
AA Change: T72I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145393
Gene: ENSMUSG00000026753
AA Change: T72I

DomainStartEndE-ValueType
PP2Ac 1 84 2.5e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204701
AA Change: T128I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145157
Gene: ENSMUSG00000026753
AA Change: T128I

DomainStartEndE-ValueType
PP2Ac 19 267 1.94e-117 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of protein phosphatase, a component of a signaling pathway regulating cell cycle progression. Splice variants encoding different protein isoforms exist. The pseudogene of this gene is located on chromosome X. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal embryonic development and embryonic lethality. Mice homozygous for a conditional allele activated in skin cells exhibit increased susceptibility to chemically induced skin tumors with increased proliferative and inflammatory responses in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Ppp6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Ppp6c APN 2 39199671 missense probably benign 0.22
IGL02551:Ppp6c APN 2 39206657 missense probably damaging 1.00
IGL02967:Ppp6c APN 2 39226217 missense probably damaging 0.98
R0399:Ppp6c UTSW 2 39200124 splice site probably benign
R0506:Ppp6c UTSW 2 39206648 intron probably benign
R2061:Ppp6c UTSW 2 39226174 missense probably damaging 0.99
R2180:Ppp6c UTSW 2 39197513 missense probably benign 0.01
R5625:Ppp6c UTSW 2 39197441 missense probably benign
R5994:Ppp6c UTSW 2 39210992 missense possibly damaging 0.95
R6785:Ppp6c UTSW 2 39197581 missense probably benign 0.00
R7346:Ppp6c UTSW 2 39226217 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATATCAGGAGATAAACCGCC -3'
(R):5'- TTAAGCACCTGCCACTGAGC -3'

Sequencing Primer
(F):5'- TATCAGGAGATAAACCGCCATGAAC -3'
(R):5'- GAGCTATATCCCAGTCTTCATCAGG -3'
Posted On2016-12-20