Incidental Mutation 'R5822:Olfr1260'
ID449965
Institutional Source Beutler Lab
Gene Symbol Olfr1260
Ensembl Gene ENSMUSG00000042894
Gene Nameolfactory receptor 1260
SynonymsGA_x6K02T2Q125-51409740-51410672, MOR232-2
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89974340-89981586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89978443 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 222 (S222P)
Ref Sequence ENSEMBL: ENSMUSP00000107137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061830] [ENSMUST00000111512] [ENSMUST00000144710] [ENSMUST00000214630] [ENSMUST00000216678]
Predicted Effect probably damaging
Transcript: ENSMUST00000061830
AA Change: S222P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053523
Gene: ENSMUSG00000042894
AA Change: S222P

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.7e-45 PFAM
Pfam:7tm_1 39 285 1.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111512
AA Change: S222P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107137
Gene: ENSMUSG00000042894
AA Change: S222P

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 7.4e-27 PFAM
Pfam:7tm_4 137 278 2.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144613
Predicted Effect probably benign
Transcript: ENSMUST00000144710
SMART Domains Protein: ENSMUSP00000119512
Gene: ENSMUSG00000042894

DomainStartEndE-ValueType
Pfam:7tm_1 39 121 4.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213162
Predicted Effect probably benign
Transcript: ENSMUST00000214630
Predicted Effect probably benign
Transcript: ENSMUST00000216678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216744
Meta Mutation Damage Score 0.5488 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Sdr39u1 A G 14: 55,897,739 V249A probably benign Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Olfr1260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1260 APN 2 89978539 missense possibly damaging 0.69
IGL01657:Olfr1260 APN 2 89977877 missense probably damaging 1.00
IGL01942:Olfr1260 APN 2 89977978 missense probably benign 0.03
IGL02139:Olfr1260 APN 2 89978429 missense possibly damaging 0.80
IGL02926:Olfr1260 APN 2 89978162 missense probably damaging 1.00
IGL03110:Olfr1260 APN 2 89978149 missense probably damaging 1.00
IGL03368:Olfr1260 APN 2 89977789 missense probably benign
R0046:Olfr1260 UTSW 2 89978507 missense probably damaging 1.00
R0046:Olfr1260 UTSW 2 89978507 missense probably damaging 1.00
R0087:Olfr1260 UTSW 2 89978131 missense probably damaging 1.00
R0599:Olfr1260 UTSW 2 89978201 missense probably benign 0.01
R1208:Olfr1260 UTSW 2 89978492 missense probably damaging 0.99
R1208:Olfr1260 UTSW 2 89978492 missense probably damaging 0.99
R1424:Olfr1260 UTSW 2 89978071 nonsense probably null
R1503:Olfr1260 UTSW 2 89978528 missense probably damaging 0.99
R1708:Olfr1260 UTSW 2 89978038 missense probably benign 0.00
R1863:Olfr1260 UTSW 2 89978410 missense probably benign 0.02
R1866:Olfr1260 UTSW 2 89978327 missense probably damaging 1.00
R2072:Olfr1260 UTSW 2 89978213 missense probably benign 0.04
R2219:Olfr1260 UTSW 2 89977912 missense possibly damaging 0.62
R4606:Olfr1260 UTSW 2 89978006 missense possibly damaging 0.79
R4674:Olfr1260 UTSW 2 89977906 missense possibly damaging 0.52
R4825:Olfr1260 UTSW 2 89978153 missense probably damaging 1.00
R6487:Olfr1260 UTSW 2 89977838 missense probably benign 0.31
R6706:Olfr1260 UTSW 2 89978585 missense probably damaging 0.96
X0050:Olfr1260 UTSW 2 89978016 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGAGAGTATGTGGCTTCCTG -3'
(R):5'- CACTTCTGTGTTCCTGAGGG -3'

Sequencing Primer
(F):5'- AGTATGTGGCTTCCTGGTTTCCAC -3'
(R):5'- AAAGGGTTTAGCATGGGTGTTATCAC -3'
Posted On2016-12-20