Incidental Mutation 'R5822:Sdr39u1'
ID449995
Institutional Source Beutler Lab
Gene Symbol Sdr39u1
Ensembl Gene ENSMUSG00000022223
Gene Nameshort chain dehydrogenase/reductase family 39U, member 1
Synonyms
MMRRC Submission 044052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5822 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55897283-55900293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55897739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 249 (V249A)
Ref Sequence ENSEMBL: ENSMUSP00000106957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022831] [ENSMUST00000111325] [ENSMUST00000226273] [ENSMUST00000227032] [ENSMUST00000227211] [ENSMUST00000228462]
Predicted Effect probably benign
Transcript: ENSMUST00000022831
SMART Domains Protein: ENSMUSP00000022831
Gene: ENSMUSG00000047153

DomainStartEndE-ValueType
low complexity region 350 365 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
Pfam:RNase_Zc3h12a 429 582 1.9e-66 PFAM
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111325
AA Change: V249A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106957
Gene: ENSMUSG00000022223
AA Change: V249A

DomainStartEndE-ValueType
Pfam:Epimerase 3 216 2.7e-7 PFAM
Pfam:DUF1731 245 291 5.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226746
Predicted Effect probably benign
Transcript: ENSMUST00000227032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227163
Predicted Effect probably benign
Transcript: ENSMUST00000227211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227268
Predicted Effect probably benign
Transcript: ENSMUST00000227387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228209
Predicted Effect probably benign
Transcript: ENSMUST00000228462
Meta Mutation Damage Score 0.0653 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) superfamily, which includes both classical and extended types. The encoded protein represents an extended type, with similarity to epimerases. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,718,856 V660M probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8a C T 11: 110,030,879 E1450K probably damaging Het
B4galnt2 T C 11: 95,866,159 Y482C probably damaging Het
Bud23 A G 5: 135,063,921 F9L probably damaging Het
Cacna1s A T 1: 136,112,078 E1214V probably damaging Het
Cdh20 T C 1: 104,934,098 M1T probably null Het
Chkb T C 15: 89,429,512 E30G probably benign Het
Crp A C 1: 172,698,068 probably benign Het
Cyp11b1 T C 15: 74,836,821 R375G probably null Het
Ddx11 C T 17: 66,129,981 S90L probably benign Het
Flnc A C 6: 29,459,430 I2510L probably damaging Het
Fyb T A 15: 6,663,226 probably benign Het
Gbp3 C T 3: 142,566,478 P247L probably benign Het
Ggn C T 7: 29,172,556 P454S probably damaging Het
Gm12800 A G 4: 101,910,243 M230V probably damaging Het
Gm813 C A 16: 58,615,712 probably null Het
Herc1 T A 9: 66,445,612 S2127T probably benign Het
Ipo11 A G 13: 106,848,418 probably benign Het
Kcnh7 G A 2: 62,716,238 R1000W probably benign Het
Kdm5b A T 1: 134,588,773 probably benign Het
Klc3 C T 7: 19,395,799 probably null Het
Lst1 A T 17: 35,188,383 M3K unknown Het
Madd C T 2: 91,152,533 R1355Q probably damaging Het
Map3k10 A G 7: 27,656,734 L920P probably damaging Het
Mdga2 A G 12: 66,655,335 V423A probably damaging Het
Mogat2 T C 7: 99,219,905 D302G possibly damaging Het
Nkapl A C 13: 21,468,423 S7A unknown Het
Npas2 A G 1: 39,347,566 S639G probably benign Het
Nr1h5 T G 3: 102,949,328 H260P probably damaging Het
Olfr117 T C 17: 37,660,231 Y34C probably damaging Het
Olfr1260 T C 2: 89,978,443 S222P probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr160 T C 9: 37,711,791 M163V probably benign Het
Olfr331 A T 11: 58,501,638 L306Q possibly damaging Het
Pan2 T C 10: 128,320,380 L1142P probably damaging Het
Pdik1l C T 4: 134,287,163 E11K possibly damaging Het
Ppp1r15a A G 7: 45,523,303 V555A probably damaging Het
Ppp6c G A 2: 39,200,052 Q81* probably null Het
Ptprz1 A T 6: 23,001,445 Y1178F probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rims2 T A 15: 39,476,490 L860Q probably damaging Het
Serhl T C 15: 83,116,327 V305A probably benign Het
Slc5a11 T C 7: 123,252,431 I201T probably damaging Het
Stk32a A T 18: 43,313,487 E334V probably benign Het
Tmem217 A G 17: 29,526,555 L67P probably damaging Het
Tnnt1 A T 7: 4,516,346 L12* probably null Het
Trim80 C T 11: 115,447,921 R526C probably damaging Het
Unc5b A T 10: 60,772,527 F635I possibly damaging Het
Utp20 T G 10: 88,817,285 N311T probably benign Het
Zfp276 A G 8: 123,255,718 T74A probably benign Het
Other mutations in Sdr39u1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Sdr39u1 APN 14 55898006 missense probably damaging 1.00
IGL02490:Sdr39u1 APN 14 55898341 missense probably damaging 0.98
IGL03074:Sdr39u1 APN 14 55899646 critical splice donor site probably null
R2240:Sdr39u1 UTSW 14 55899667 missense probably damaging 1.00
R5937:Sdr39u1 UTSW 14 55897907 missense probably damaging 1.00
R6377:Sdr39u1 UTSW 14 55897709 missense probably benign 0.00
R6620:Sdr39u1 UTSW 14 55897715 missense probably damaging 1.00
R7685:Sdr39u1 UTSW 14 55897734 nonsense probably null
R7710:Sdr39u1 UTSW 14 55899659 missense probably benign 0.13
R7996:Sdr39u1 UTSW 14 55897887 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCAAGTGCAGGGATCATCAC -3'
(R):5'- TCTTCCCCTGGATACACATTGG -3'

Sequencing Primer
(F):5'- AGTGCAGGGATCATCACCTGAC -3'
(R):5'- ACATTGGTGACCTGGCAG -3'
Posted On2016-12-20