Incidental Mutation 'R5823:Acsl3'
ID450010
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Nameacyl-CoA synthetase long-chain family member 3
Synonyms2610510B12Rik, Facl3, C85929
MMRRC Submission 043215-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R5823 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78657825-78707743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78688286 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 143 (R143L)
Ref Sequence ENSEMBL: ENSMUSP00000121695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000135642] [ENSMUST00000142704]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
AA Change: R143L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: R143L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132997
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135642
SMART Domains Protein: ENSMUSP00000116576
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142704
AA Change: R143L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: R143L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154777
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,930,552 I162N probably damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
4933406M09Rik T A 1: 134,390,917 W476R probably damaging Het
Ankrd11 A T 8: 122,895,790 I420K probably benign Het
Cwh43 A G 5: 73,411,870 E85G probably benign Het
Dnah1 G T 14: 31,266,418 F3442L possibly damaging Het
Dock6 T A 9: 21,804,828 N1737I probably damaging Het
Fcf1 A G 12: 84,974,147 Y55C possibly damaging Het
Fer1l6 T A 15: 58,590,503 Y802* probably null Het
Fgf9 T G 14: 58,083,302 S10A probably damaging Het
Fhad1 A G 4: 141,955,306 I508T possibly damaging Het
Flnc T C 6: 29,461,202 V2692A probably damaging Het
Gm38119 G T 3: 92,738,073 H71Q unknown Het
Hcn1 A T 13: 117,602,852 H50L unknown Het
Helz2 T C 2: 181,236,396 T870A possibly damaging Het
Iqcf4 T C 9: 106,568,601 I116V probably benign Het
Lama5 T A 2: 180,192,492 I1383F probably benign Het
Lmo2 C T 2: 103,981,072 T150I probably damaging Het
Myh13 A G 11: 67,360,468 E1391G probably damaging Het
Mylk T A 16: 34,894,947 probably null Het
Nat10 A T 2: 103,730,267 V731D probably damaging Het
Ncapd2 A G 6: 125,168,700 V1328A probably benign Het
Nfu1 C A 6: 87,025,559 Q207K probably damaging Het
Nipsnap2 T A 5: 129,739,769 probably null Het
Npc1 T C 18: 12,191,789 K1216E possibly damaging Het
Olfr457 C A 6: 42,471,972 V69L probably benign Het
Phf3 T C 1: 30,804,683 I1732V probably damaging Het
Rasgrp4 G T 7: 29,137,717 R67L probably benign Het
Rubcn T C 16: 32,849,721 D88G probably damaging Het
Slc30a2 T C 4: 134,345,978 I112T probably damaging Het
Slc35d2 A G 13: 64,120,605 I78T probably damaging Het
Slc9a4 T A 1: 40,619,117 M600K probably damaging Het
Slfn8 A G 11: 83,016,736 I327T probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tex15 A G 8: 33,570,934 I405V possibly damaging Het
Thsd7b T C 1: 129,678,084 S521P probably benign Het
Trim36 A G 18: 46,169,340 L535P probably damaging Het
Trim63 A T 4: 134,316,531 I102F probably damaging Het
Wdr47 G A 3: 108,643,085 V809M probably damaging Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78699759 missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78699153 missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78699170 critical splice donor site probably null
R0601:Acsl3 UTSW 1 78696179 missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78701287 missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78688282 missense probably benign
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1468:Acsl3 UTSW 1 78706409 missense probably benign 0.03
R1697:Acsl3 UTSW 1 78705397 splice site probably benign
R2083:Acsl3 UTSW 1 78699811 missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78681961 missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78699140 missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78699110 missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78705368 missense probably benign 0.00
R2964:Acsl3 UTSW 1 78694294 missense probably benign 0.01
R3403:Acsl3 UTSW 1 78696122 missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78690346 missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78706356 missense probably damaging 1.00
R6239:Acsl3 UTSW 1 78696465 missense probably benign 0.00
R6376:Acsl3 UTSW 1 78696465 missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78681922 missense probably benign 0.03
R7031:Acsl3 UTSW 1 78688283 missense probably benign
R7282:Acsl3 UTSW 1 78681992 missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78688236 critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7974:Acsl3 UTSW 1 78703588 missense probably benign 0.02
R7998:Acsl3 UTSW 1 78694271 missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78681894 missense probably damaging 1.00
X0025:Acsl3 UTSW 1 78692202 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATGGACAATGTCACAAAGC -3'
(R):5'- CCCGGTATCAGAATGCTAACC -3'

Sequencing Primer
(F):5'- ACATCTTCACTTGAAACTAAC -3'
(R):5'- CAAGGCTACGTAGAGACTCTGTC -3'
Posted On2016-12-20