Incidental Mutation 'R0549:Cdh7'
ID 45002
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Name cadherin 7, type 2
Synonyms CDH7L1
MMRRC Submission 038741-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0549 (G1)
Quality Score 204
Status Validated
Chromosome 1
Chromosomal Location 109982431-110140157 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110108944 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 618 (L618P)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
AlphaFold Q8BM92
Predicted Effect probably damaging
Transcript: ENSMUST00000027542
AA Change: L618P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: L618P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112701
AA Change: L618P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: L618P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect unknown
Transcript: ENSMUST00000134301
AA Change: L138P
SMART Domains Protein: ENSMUSP00000123394
Gene: ENSMUSG00000026312
AA Change: L138P

DomainStartEndE-ValueType
CA 24 111 2.26e-9 SMART
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172005
AA Change: L618P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: L618P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A G 17: 46,322,290 F498L probably damaging Het
Adamts6 A T 13: 104,297,255 D64V possibly damaging Het
Agbl2 T C 2: 90,789,843 probably benign Het
Angptl3 A G 4: 99,031,455 S151G probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
C4b G T 17: 34,735,415 L927I probably damaging Het
Ccl3 T C 11: 83,648,336 T66A probably damaging Het
Cfap65 T C 1: 74,918,444 T989A probably benign Het
Cnpy4 T C 5: 138,187,637 F18S possibly damaging Het
Col6a5 A G 9: 105,904,579 probably benign Het
Dppa2 G A 16: 48,318,671 R289H probably benign Het
Evx2 T C 2: 74,659,134 T96A probably benign Het
Frmd4a A G 2: 4,603,967 E577G possibly damaging Het
Gcgr G A 11: 120,536,561 G166S probably benign Het
Gm4788 A T 1: 139,739,488 D377E probably damaging Het
Gm5316 T C 6: 122,900,191 noncoding transcript Het
Gria1 G A 11: 57,228,973 R292Q probably damaging Het
Hars2 T A 18: 36,786,208 probably null Het
Hkdc1 T A 10: 62,400,240 T508S probably benign Het
Kif2b A T 11: 91,576,584 I291N probably damaging Het
Lmbrd1 A T 1: 24,744,920 T377S probably benign Het
Lrrc28 A G 7: 67,628,342 probably benign Het
Mmp3 A T 9: 7,455,638 N463I probably benign Het
Myh6 A G 14: 54,958,608 F578S probably damaging Het
Ncbp1 T A 4: 46,168,476 M608K possibly damaging Het
Nf1 T C 11: 79,468,771 F1412L probably damaging Het
Nlrp5 T A 7: 23,441,802 W1083R probably damaging Het
Nrsn1 T C 13: 25,262,258 Y45C probably benign Het
Olfr401 T G 11: 74,121,475 M62R probably damaging Het
Osbpl7 G T 11: 97,067,542 R881L probably damaging Het
Papss1 A G 3: 131,619,213 E456G possibly damaging Het
Pbxip1 T A 3: 89,443,592 probably benign Het
Pcca A G 14: 122,638,377 probably benign Het
Pde1a T A 2: 79,865,070 N511I probably damaging Het
Prpf39 A T 12: 65,056,256 I435F probably benign Het
Rnf213 C T 11: 119,465,082 T4117M probably damaging Het
Sel1l2 A T 2: 140,265,882 M216K probably damaging Het
Sidt2 A G 9: 45,953,119 probably null Het
Sirt3 A T 7: 140,869,487 probably null Het
Smpd4 T C 16: 17,639,312 V378A probably benign Het
Svil T A 18: 5,064,566 S642T possibly damaging Het
Tcp10a A G 17: 7,326,551 K92E probably benign Het
Tmem144 T C 3: 79,822,744 D233G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnik T C 3: 28,570,920 S335P possibly damaging Het
Ush2a T C 1: 188,946,953 L4786P probably damaging Het
Utp11 A T 4: 124,686,079 probably benign Het
Vmn1r67 A G 7: 10,447,714 N241D probably damaging Het
Vmn2r11 A T 5: 109,052,097 C497S possibly damaging Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1033:Cdh7 UTSW 1 110085053 missense probably damaging 0.96
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1769:Cdh7 UTSW 1 110052876 missense probably damaging 1.00
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1940:Cdh7 UTSW 1 110049024 missense probably benign 0.09
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2137:Cdh7 UTSW 1 110100106 missense probably damaging 0.97
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R5867:Cdh7 UTSW 1 110048851 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
R7511:Cdh7 UTSW 1 109997853 intron probably benign
R7532:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R7879:Cdh7 UTSW 1 110048947 missense probably benign 0.01
R7978:Cdh7 UTSW 1 109994105 start gained probably benign
R8022:Cdh7 UTSW 1 110061108 missense probably benign 0.02
R8207:Cdh7 UTSW 1 109994346 missense probably damaging 1.00
R8224:Cdh7 UTSW 1 109994203 missense probably benign
R8239:Cdh7 UTSW 1 110100102 missense probably benign 0.11
R8749:Cdh7 UTSW 1 110099279 missense probably damaging 1.00
R8884:Cdh7 UTSW 1 110100130 missense probably damaging 1.00
R9030:Cdh7 UTSW 1 110100113 missense probably benign 0.21
R9498:Cdh7 UTSW 1 110048905 missense probably benign 0.03
R9658:Cdh7 UTSW 1 110061055 missense probably damaging 0.99
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Z1176:Cdh7 UTSW 1 110108736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTAACAGTTCACAGTTCCCTTCTCTTTT -3'
(R):5'- GGTGAGTAGTGTGTCATAGTTTAACATCTGGT -3'

Sequencing Primer
(F):5'- aaacaaaaaACCAAAAAACTTATGGC -3'
(R):5'- TGAGACAAGAAAACTTATGGTGTTT -3'
Posted On 2013-06-11